2 examples of fees that are associated with checking accounts.

Answers

Answer 1

2 examples of fees that are associated with checking accounts are overdraft fees, ATM fees.

What are checking accounts fees?

Checking account fees may be charged by banks when customers make certain transactions or fail to maintain a set minimum balance. These fees can add up, but fortunately many of them are also avoidable. Checking account fees to watch out for include overdraft fees, ATM fees and monthly service fees. The bank might charge a fee each month, just for having the account. We might also be charged a fee if our balance drops below the required minimum.

Some accounts charge a fee for each check we write.

Learn more about checking, here:

https://brainly.com/question/4307591

#SPJ1


Related Questions

Interesting ww2 factoid about communism

Answers

Answer:

Explanation:

its 2:11 gts

Two women that began to question their place and treatment in American
society during the war?

Answers

Answer: Abigail Adams, Deborah Sampson, and Mary Hays (also known as Molly Pitcher).

Explanation:

Abigail Adams was a strong voice for women during the revolution, often urging her husband (Future President John Adams) to remember America's women in the new government they were creating. She was an early advocate for women's rights and education.

Deborah Sampson disguised herself as a man to enlist in the army under the name Robert Shurtliff, she refused to tell a doctor she had been shot in the thigh to protect her identity and performed first aid on herself, she was later discovered and honorably discharged.

Mary Hays/Molly Pitcher was a female who helped deliver water to the troops during battle, her husband was a gunner who was wounded in action so she took over his position in battle.

which shift in global power characterizes the beginning of the mordern era?

Answers

The Industrial Revolution in Great Britain led to its growth as a superpower. Thus, option 'A' is the correct option.

How industrial revolution led to a superpower?

The globe underwent contemporary industrialisation as a result of the Industrial Revolution. It significantly altered the path of history. It accelerated urbanization and fueled the growth of cities and nations. The first innovative inventions that resulted in the development of machines and mass manufacturing during the industrial revolution were made in Great Britain.

As a result, the nation amassed riches and money and rose to the status of a global superpower. It encouraged people to dwell in cities, increased domestic production and transportation, and temporarily propelled Britain to the top of the global power rankings.

Learn more about global power, here:

https://brainly.com/question/29974455

#SPJ1

Probably the correct options are:

A. The Industrial Revolution in Great Britain led to its growth as a superpower.

B. Persian and Ottoman control of trade routes allowed those empires to become wealthy.

C. German military technology allowed it to conquer most of Western Europe.

D. The revival of Greek and Roman culture brought a focus to those areas of the world.

Before slave trade what was africa culture like

Answers

Africans lived in city-states and kingdoms, each with its own language and culture. The kingdoms of Mali, Benin, and Kongo, as well as the vast and influential Songhai Empire, all had great rulers who oversaw intricate political systems that were in charge of tens of thousands of citizens.

How did slavery affect African culture?

With the help of the Pope, the Portuguese overran the African port of Ceuta in 1415 and were the first so-called "Western" slavers to do so. While the Portuguese and Spanish were enslaved the native people in central and southern America, there was only a tiny amount of native Africans traded as slaves during the 15th century.

As a result, some states, like Asante and Dahomey, gained strength and wealth. While being absorbed by rivals, other states were totally annihilated, with their inhabitants decimated. As a result of the forced eviction of millions of Africans from their homes, cities and villages became depopulated.

Learn more about slavery in Africa, from:

brainly.com/question/14213266

#SPJ1

After a ruling, a justice of the Supreme Court explains why the Court ruled the way it did. Which term best describes the justice's actions?
A.
Precedent
B.
Majority opinion
C.
Judicial review
D.
Dissent

Answers

Dissenting judgments are, in essence, decisions made by one or more judges of a particular court who do not agree with the majority opinion and express their views on the matter in a manner that is different from that of the majority of the bench. As a result, choice (D) is correct.

What is Dissenting opinion?

In certain legal systems, a dissenting opinion (or dissent) is an opinion in a case made by one or more judges that expresses disagreement with the majority opinion of the court that led to its verdict.

To put it simply, dissenting judgments are those rendered by one or more judges of a given court who do not agree with the majority decision and express their views on the matter in a manner that is distinct from that of the bench as a whole.

Hence, option (D) is accurate.

Learn more about Dissenting opinion, from:

brainly.com/question/3965318

#SPJ1

5. Elaborate the values of the ancient and medieval socio-cultural achievements on the present country's economy.​

Answers

Answer:The ancient and medieval socio-cultural achievements of a country have had a lasting impact on its present economy. These achievements have provided a foundation for the development of the country's economic system, and have helped to shape its current economic landscape.

Explanation:

A nation's modern economy has been significantly influenced by its achievements in ancient and medieval socio-cultural life. These accomplishments laid the groundwork for the growth of the nation's economic system and influenced the present economic climate.

How do cultural values affect socioeconomic development?

Sociocultural values have an impact on how members of society engage in the process of development, which has an impact on economic development. Risk propensity, or the degree of risk that the general public is ready to take, is one of these values. A foundational model of endogenous economic growth includes cultural factors. Hypotheses: Economic growth benefits from cultural values of hard work and economy.

Cultural perspectives on postmaterialism have a detrimental impact on economic expansion. Culture has inherent worth, but it also has significant social and economic advantages. Culture improves our quality of life and boosts overall well-being for both individuals and communities via better learning and health, higher tolerance, and chances for social interaction.

Learn more about medieval socio-cultural, here:

https://brainly.com/question/13580518

#SPJ2

WHy does the commissioner of Indian affairs recommend handling relations between the US government and the American Indians under its vontrol and why foes he think this is the best approach

Answers

The purpose of the Bureau of Indian Affairs is to improve the standard of living for American Indians, members of Indian tribes, and Alaska Natives while also fostering economic opportunity.

What do you mean by the Indian affairs?

The primary interface between the federally recognized Native American populations (formally, American Indian tribes) and the federal government is the Interior Department.

It is in charge of carrying out federal rules and regulations pertaining to American Indians and Alaska Natives, as well as administering and maintaining more than 55,700,000 acres (225,000 km2) of land held in trust for Indian Tribes by the U.S. federal government.

The assistant secretary for Indian affairs, who reports to the secretary of the interior, is in charge of the BIA and acts as its director.

Therefore, the purpose of the Bureau of Indian Affairs is to improve the standard of living for American Indians, members of Indian tribes, and Alaska Natives while also fostering economic opportunity.

To know more about the Indian affairs, visit:

https://brainly.com/question/11869767

#SPJ1

What sparked Metacom to attack the English settlements?
opportunity
jealousy over English wealth
underhanded dealings with the tribe
rejection of Christianity

Answers

Answer:

all

Explanation:

Prepare a list of qualifications for a government to be considered totalitarian.

Answers

Explanation:

you need to try doing it your self so you can

What are the main ideas of this poster? Choose three answers.

Answers

The main ideas of this poster are

Women are being encouraged to work on the home front during the war.Women can select jobs that correspond to their interests or skills.Jobs related to wartime industries have the greatest need for workers.What is a poster?

A poster is a graphical or photographic depiction of any concept intended to encourage or promote something. These posters are used for advertising or to educate the public about any problems or difficulties that society faces.

The women were informed of the various employment opportunities that were available, allowing them to manage both their homes and their occupations. they were given the chance to select a position that would allow them to effectively demonstrate their abilities and competence.

Learn more about posters, here:

https://brainly.com/question/12555816

#SPJ1

The complete question is probably

The poster shows how propaganda supported the war effort at home.

What are the main ideas of this poster? Check all that apply.

Women are being encouraged to work on the home front during the war.

Women can select jobs that correspond to their interests or skills.

Jobs related to wartime industries have the greatest need for workers.

Jobs in industry, agriculture, and business are specifically in need of workers.

Women’s right to work in these industries will be supported after the war.

How was propaganda used by the Nazi government to shape the views of the German people?

Answers

The Nazi government, led by Adolf Hitler, used propaganda to shape the views of the German people in several ways. They used a variety of mediums, including posters, films, newspapers, and rallies, to disseminate their ideas and influence public opinion.

One of the main goals of Nazi propaganda was to create a sense of national unity and to promote the idea of a national community (Volksgemeinschaft) that transcended social and economic class. The Nazis presented themselves as the only party that could bring about national renewal and restore Germany to its former glory after its defeat in World War I.

It's important to note that the use of Propaganda was not unique to Nazi Germany but it was highly centralized, pervasive and effective. It was also heavily reinforced by the secret police (Gestapo) and the SS that would use violence and repression to ensure that everyone was loyal and compliant to the government's message.

Learn more about nazi government:

https://brainly.com/question/26319361

The propaganda tools used by the Nazi government to shape the views of the German people were film, radio, newspapers, books, posters, and speeches.

Propaganda played a significant role in the Nazi regime's efforts to shape the views of the German people. The Nazi government, under the direction of Joseph Goebbels, used a variety of methods and mediums to disseminate propaganda, including film, radio, newspapers, books, posters, and speeches. The goal of this propaganda was to create a single, unified narrative that supported the Nazi party's political agenda and ideals and to create a sense of national pride and solidarity among the German people.

One of the main techniques used by the Nazi propaganda machine was to create a sense of fear and urgency by emphasizing the threats posed by Jews, communists, and other perceived enemies of the state. This helped to create a sense of unity among the German people and a shared enemy.

The Nazi regime also used propaganda to create a cult of personality around Adolf Hitler, portraying him as a strong, charismatic leader who was a saviour for Germany. This was done through images, symbols, and slogans that emphasized his strength and leadership.

The Nazi regime also used education, the arts, and the media to ensure the German people were exposed to the same ideas and that any dissenting views were suppressed. They created strict censorship laws to control the content of newspapers, books, radio, and films. They also established centralized control over the education system to ensure that the Nazi version of history and ideology were taught in schools.

In addition, the Nazi regime used propaganda to create a sense of social conformity and control people's behavior. They emphasised traditional gender roles, religious values, and racial purity, which helped create a sense of moral righteousness and duty among the German people.

It's important to note that the propaganda used by the Nazi government was not only sophisticated but also highly effective in shaping the views of the German people and creating support for the Nazi party's ideals and agenda, leading to a society where dissent was effectively silenced and the population turned a blind eye to the atrocities committed by their leaders and fellow citizens.

Learn more about Nazi government:

https://brainly.com/question/15383743

What was the Samurai equivalent in European Feudalism?

a
serf
b
noble
c
knight
d
king

Answers

The warriors, known as knights in Europe and samurai in Japan, served the local lords. The warriors adhered to a code of ethics in both situations.

What do you know about knights?

A person who has received the honorific title of knighthood from a head of state or official representative is said to have rendered service to the monarch, the church, or the nation, particularly in a military capacity.

The Greek hippies and hoplites as well as the Roman eques and centurion of classical antiquity are the ancestors of knighthood. European mounted warriors were awarded knighthood throughout the Early Middle Ages.

In the High Middle Ages, becoming a knight was seen as a lower order of aristocracy. By the Late Middle Ages, the position had come to be connected with chivalric ideals, a set of rules for the ideal Christian courtier.

Learn more about knights, here

https://brainly.com/question/838180

#SPJ1

which tactic was primarily used by the civil rights movement in the 1950 and 1960s

Answers

In contrast, the Civil Rights Movement's founders opted for nonviolence as a strategy for eradicating systemic racism, discrimination, and injustice.

What were the tactics of the civil rights movement in the 1960s?

The struggle's defining tactics included sit-ins, boycotts, marches, and acts of civil disobedience, during which hundreds of people were detained. Numerous thousands took part in protests, boycotts, and campaigns to register voters. King, Martin Luther. The movement's nonviolent tactic of demonstrating equal rights played a significant role in its success. This strategy was supported by civil rights activist Rev. Martin Luther King as an alternative to violent revolt.

Learn more about civil rights, here:

https://brainly.com/question/21057720

#SPJ1

Encyclopedias and other reference works you can find online that explain the basics of a broad range of human interests are part of the legacy of

a. Hobbes
b. Montesquieu
c. Diderot
d. Locke

Answers

Encyclopedias and other reference work you can find online that explain the basics of a broad range of human interests are part of the legacy of Diderot. Thus, option C is correct.

What is an encyclopedia?

Encyclopedias serve the objective of providing scope where the issue belongs in the wider structure of knowledge—in addition to offering basic summaries of topics and responses to straightforward facts.

Denis Diderot was the one expressing both the spirit of rationality and the accepted level of intellectual understanding with their contribution to Encyclopedias. Therefore, option C is the correct option.

Learn more about encyclopedia, here:

https://brainly.com/question/13956571

#SPJ1

Answer: Option C-Diderot

Explanation: I got it right on the test :)

80 points
Refer to The Mary Celeste: An Unsolved Mystery from History for a complete version of this text.

Part A

Which statement is a main idea of The Mary Celeste: An Unsolved Mystery from History?

Responses

There are many possible explanations for why the crew of the ship disappeared.
There are many possible explanations for why the crew of the ship disappeared.

The crew that found the Mary Celeste won the trial for the right to claim its cargo.


People believe that the Mary Celeste was cursed because of her negative history.


It is very uncommon for a crew to rebel against its captain and take over the ship.

Answers

Answer:

It is very uncommon for a crew to rebel against its captain and take over the ship.

Explanation:

There are many possible explanations for why the crew of the ship disappeared.

We received color based on light that is

Answers

The wavelength of reflected light into our eyes determines color.

Which of the following answers is the correct chronological order of events during the Russian Revolution?
Select one:

Bloody Sunday, World War I, Tsar Nicholas’ abdication, assassination of the Romanov family

World War I, Bloody Sunday, assassination of the Romanov family, Tsar Nicholas’ abdication

March Revolution, Tsar Nicholas’ abdication, assassination of the Romanov family, World War I

World War I, Tsar Nicholas’ abdication, Bloody Sunday, assassination of the Romanov family

Answers

Chronological order of events during the Russian Revolution is as follows:

Bloody Sunday, World War I, Tsar Nicholas’ abdication, assassination of the Romanov family

The correction answer is the first option.

Bloody Sunday was in 1905. Up to 200 people were killed by rifle fire and Cossack charges. This event became known as Bloody Sunday and is seen as one of the key causes of the 1905 Revolution.

World War I was between 28 July 191411 November 1918

Tsar Nicholas' abdication was in 15 March 1917.

Assassination of the Romanov family took place on July 17, 1918.

Learn more about Russian revolution here

https://brainly.com/question/810738

#SPJ1

Question 9 of 10
Why were more Americans able to buy homes after World War II?
OA. Banks were less involved in the buying process
OB. Home prices fell to record lows
C. People were more willing to take on debt
OD. All of the above
SUB

Answers

After World War II, more Americans were able to purchase homes because more people were ready to take on debt.

Who started World War II?

The Second World War, or simply World War II, was a conflict that spanned nearly the whole world from 1939 to 1945. The primary combatants were the Axis forces, which consisted of Germany, Italy, and Japan, and the Allies, which included France, Great Britain, the United States, the Soviet Union, and to a lesser extent, China. The war in many ways continued the problems that World War I left unaddressed after an unsettling 20-year hiatus. Between 40 and 50 million people died in World War II, the biggest and bloodiest conflict in history.

Along with World War I, World War II was one of the great turning moments in world history throughout the 20th century.

To know more about, World War, visit:

https://brainly.com/question/15506454

#SPJ1

what is Protecting natural resources and the environment is often times known as what?

Answers

Answer:

Earth's natural resources include air, minerals, plants, soil, water, and wildlife. Conservation is the care and protection of these resources so that they can persist for future generations.

"And whereas great Quantities of the like Manufactures have of late been made and are daily increasing in the Kingdom of Ireland and in the English Plantations in America and are exported from thence to Forreigne Marketts heretofore supplyed from England which will inevitably sink the Value of Lands and tend to the ruine of the Trade and the Woollen Manufactures of this Realme ... Be it enacted by the Kings most Excellent Majesty by and with the Advice and Consent of the Lords Spirituall and Temporall and Commons in this present Parliament assembled and by the Authority of the same:

That no Person or Persons ... shall directly or indirectly export ... out of or from the said Kingdom of Ireland into any Forreigne Realme States or Dominions ... other than the Parts within the Kingdom of England."—Wool Act, 1699

Even after the British Parliament enacted policies like the Wool Act of 1699, how did the colonial industries continue to thrive? (1 point)

A. Active piracy
B. Salutary neglect
C. Raising prices
D. Superior quality

Answers

The answer here is b salutary neglect

How did this help support the war effort during World War II Volunteerism, Enlistment, and Patriotism

Answers

Answer: without these very useful happenings, the US would have had less Troops, less of a workforce, and no support whatsoever

Explanation:

What position did the U.S. take
regarding the conflict in Europe at
the beginning of World War I in
1914?
A. The U.S. was associated with the Triple
Alliance.
B. The U.S. supported Serbia's Black Hand
group.
C. The U.S. declared itself neutral and not
involved.
D. The U.S. was associated with the Central
Powers.

Answers

Answer:

C. The U.S. declared itself neutral and not involved.

Explanation:

In August 1914, President Woodrow Wilson declared American neutrality in the war. He declared neutrality “in thought as well as in action”, calling on all Americans to remain impartial in their thoughts and sympathies.

2023 is the what? a.new year b.last year?

Answers

Answer: a

Explanation:

because it just is my man

How was the Islamic caliphate a successor to rome

Answers

Islam was one of Rome's successors, and its adherents founded a caliphate that would eventually annexe a sizable section of the ancient Roman Empire.

Who is the real successor of Rome?

The Ottoman Empire and the Russian Empire, which both asserted succession to the Byzantine Empire after 1453, have been the most persistent and major claims of the continuity of the Roman Empire in the East. The Muslim community had to select Muhammad's successor after his passing. The majority of Muslims worldwide—roughly 90%—are Muslim population.

They consider Abu Bakr, Muhammad's father-in-law & closest friend, to be his legitimate successor. The Ottoman Sultan Mehmet II's conquest of Constantinople in 1453 signified the end of the Roman Empire and the beginning of the first successor Empire.

To know more about Roman Empire, visit:

https://brainly.com/question/1892495

#SPJ1

What did Ravana look like?

Answers

Answer:

If you're referring to the rakshasa hindu king of the island of Lanka, I'm pretty sure there aren't any perfectly accurate pictures or paintings of how he looked like but many interpretations of how people imagined him to look like. I'm sure you could find many online that could create a better image for you

Hope this helps!

Total population count

Answers

Answer:

in 2022 the world population reached 8 billion people

Explanation:

The Total Population Count:

8 billion people

PLEASE HELP!!! 6.15 UNIT TEST:EAST ASIA 300-1300: CHINA AND JAPAN- PART 1 (K12)

Which statements about the Tale of Genji are correct.?

Select all correct answers.

A. It is widely considered the world's first novel.

B. It describes life in a Chinese village.

C. It created a storytelling model still used today.

D. It was written during a "golden age" of Japanese literature.​

Answers

Answer:

A. It is widely considered the world's first novel.

D. It was written during a "golden age" of Japanese literature.

Explanation:

The Tale of Genji is a Japanese novel written by Murasaki Shikibu, a noblewoman and lady-in-waiting at the Imperial Court during the Heian period of Japanese history. It is widely considered to be the world's first novel and is an important work of Japanese literature that has had a lasting influence on the country's culture and literature. The Tale of Genji was written during a period known as the "golden age" of Japanese literature, which lasted from the late 10th century to the early 12th century. It is a romantic and psychological portrayal of the life and loves of Prince Genji, and it created a storytelling model that is still used today.

A. It is widely considered the world's first novel.

D. It was written during a "golden age" of Japanese literature.

C. It created a storytelling model still used today.

The Tale of Genji is a Japanese novel written by Murasaki Shikibu, a noblewoman and lady-in-waiting at the Imperial Court during the Heian period of Japanese history. It is widely considered to be the world's first novel and is an important work of Japanese literature that has had a lasting influence on the country's culture and literature. The Tale of Genji was written during a period known as the "golden age" of Japanese literature, which lasted from the late 10th century to the early 12th century. It is a romantic and psychological portrayal of the life and loves of Prince Genji, and it created a storytelling model that is still used today.

It may be A because it is the first novel that was writer by a women now if I know it’s the first novel ever well I don’t sorry. It is B bc it is set please in a Chinese village. I don’t think C is one of the answers, and this novel was created in the golden age of Japanese literature i think

I hope this helps I do K12 too so

The US Constitution of this money of your fundamental rights what words and phrases are associated with your rights what what our country and life to be like if the constitution didn’t agree with peoples rights?

Answers

People would be unable to engage in activities that are particular to their personalities, such as speaking or learning a language. Saying what they thought to be true or gathering to protest against something unjust would be prohibited.

What would happen if there is no constitution in our country?

There won't be any laws or norms to control the populace and the social order if there is no constitution. The government may abuse its authority by carrying out its own agenda and oppressing the populace by denying them access to their basic freedoms and rights.

Without human rights, there cannot be long-lasting peace, stability, or safety. No democracy, equality, or opportunity to express oneself. No hope for an internet that prioritizes people over profit, no solution to the digital divide, and no online safety.

To learn more about constitution

https://brainly.com/question/29799909

#SPJ1

Eipisin one example of how British actions affected U.S. history during this time period. How might history he
changed if different events hed happened?

Answers

The Embargo Act of 1807, a reaction to British policy of impressing American sailors into the Royal Navy, serves as an illustration of how British activities during this era had an impact on American history.

What is Embargo Act?

The United States Congress passed the Embargo Act, which prohibited all exports from the nation, in an effort to exert pressure on Great Britain to stop impressing American sailors.

It had a severe impact on the American economy, which was heavily dependent on trade with Great Britain, and resulted in significant economic hardship for many people.

It's also crucial to remember that because Americans and American companies disliked the Embargo Act, it contributed to Jefferson's party losing the ensuing presidential elections.

To know more about Embargo Act, refer:

brainly.com/question/249204

#SPJ1

How did John Quincy Adams fight against slavery as a member of Congress?
OA. He proposed that Congress accept the gag rule on slavery.
B. He argued for the immediate abolition of slavery.
OC. He argued that slavery should not be allowed to spread to new
states.
O D. He proposed the Compromise of 1850 to keep the United States
together.

Answers

He argued that slavery should not be allowed to spread to new states. As a member of Congress, John Quincy Adams argued against the expansion of slavery to new states.

What is slavery?

Slavery is the practice of one person owning another person as property and forcing them to work without pay or consent. It is a form of human exploitation and is considered a violation of human rights. It is an extreme form of exploitation that has been practiced throughout history in many different societies and cultures. Slavery has been outlawed in most countries, but it still exists in some parts of the world today.

He proposed the Missouri Compromise, which prohibited slavery in the Louisiana Territory north of the 36°30' latitude line, in order to prevent the spread of slavery. He also introduced legislation to abolish slavery in the District of Columbia and was an outspoken opponent of the Fugitive Slave Law.

To learn more about slavery
https://brainly.com/question/28808482
#SPJ1

Other Questions
A rise in oil prices has caused input prices to increase throughout the economy, causing nominal GDP to increase by 13%. Meanwhile, the price level decreases by 2%. What is the real GDP growth rate during this period Robin tosses a pair of 6-sided dice. The odds in favor of the sum of the 2 dice rolls being greater than 8 are 5:13.What is the probability that the sum of the 2 dice rolls will not be greater than 8? DefinitionUnit 6 Vocab: DNA, RNA, and Protein Synthesisnucleic acid molecule that allows for the transmission of genetic information anprotein synthesisYour answer What are the 4 names of an angle? Tech A says that all hazards can be removed from a shop. Tech B says that you should disconnect an air gun before inspecting it. Who is correct A follow-up experiment revealed that the genetic content of the bacterial cells was altered by the transfer of material from the phage. This process is best described as: PLEASE HURRY AND HELP!!!Which of the following tables represents a linear relationship that is also proportional?x y0 33 66 9x y0 42 64 8x y0 06 312 6x y0 35 510 7 what are the two quantities in this module for which we will develop unit factors to do dimensional analysis with chemical substances? Spring and Summer can alsosymbolize marriage ortogetherness. Which of thefollowing pairs was NOTbrought together in some wayduring Acts IV-V of "TheWinter's Tale"? At the places where 180 degrees of longitude and the International Date Line meet, there is a change of _________ as you cross the International Date Line. Termination of the postsynaptic potential would be expected from a drug or process that acts to a. blocks transport of the neurotransmitter molecule through the axon membrane. b. enzymatically degrade the neurotransmitter molecule. c. increase the number of postsynaptic receptors. d. increase release of the neurotransmitter. e. increase synthesis of the neurotransmitter molecule. When two lines make an angle of 90 degree is known as? Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA Helllllp please ???? Which of the following occurs when a person reaches the age of majority and states, either orally or in writing, that he or she intends to be bound by the contact entered into as a minor?Multiple ChoiceDisaffirmanceImplied novationImplied ratificationExpress novationExpress ratification What is the area of equilateral having side 12 cm? What is the value FG? solve the equation a^2x^2 = abx + 2b^2 using completing the square method Lupe wrote two different fractions with the same denominator. both fractions were less than 1. can their sum equal? can their sum be greater than 1? What number would you need to multiply the first equation by to eliminate the y variable when solving the system of equations by elimination?