4-37 Una chica extraordinaria. Paso 1.
Julia Catalina Flores has an extraordinary talent for a girl her age. Read the article about Julia and select the forms of saber and conocer, or use tab to navigate to the item on screen and control key to select an item.
Julia Catalina Flores: la charanguista más joven de El Progreso
Julia Catalina Flores Ramírez sabe tocar la guitarra y desde la edad de 6 años toca en la banda de su papá.
¿Conoces a Julia? Pues si la ves en el grupo de su padre vas a saber que es una chica extraordinaria. Aunque es pequeña y tímida es una experta con el charango un instrumento similar a la guitarra. Es de una madera hondureña muy especial y rara. Ella dice que conoce su charango como a un miembro de su familia. Julia vive en el pueblo de El Progreso en el norte de Honduras. Cuando las personas la escuchan tocar están maravilladas por su talento. Ella dice que le gusta tocar con su familia y hacer feliz a la gente. Ya sabe tocar más de 200 canciones. Si la quieres escuchar el grupo cobra (charges) unos 25 lempiras por canción. Pero tienes que viajar a Honduras porque ella es muy joven para salir,de,viaje,como,música,profesional.

Answers

Answer 1

Julia Catalina Flores Ramírez sabe tocar la guitarra y desde la edad de 6 años toca en la banda de su papá.

¿Conoces a Julia? Pues si la ves en el grupo de su padre vas a saber que es una chica extraordinaria. Aunque es pequeña y tímida, es una experta con el charango, un instrumento similar a la guitarra. Es de una madera hondureña muy especial y rara. Ella dice que conoce su charango como a un miembro de su familia.

En este contexto, el verbo "sabe" se utiliza en el sentido de tener habilidad o conocimiento para tocar la guitarra y el charango.

Julia vive en el pueblo de El Progreso en el norte de Honduras. Cuando las personas la escuchan tocar, están maravilladas por su talento. Ella dice que le gusta tocar con su familia y hacer feliz a la gente. Ya sabe tocar más de 200 canciones. Si la quieres escuchar, el grupo cobra unos 25 lempiras por canción. Pero tienes que viajar a Honduras porque ella es muy joven para salir de viaje como músico profesional.

En este caso, el verbo "conoce" se utiliza para expresar que Julia está familiarizada con su charango y lo considera parte de su familia.


Related Questions

Casi todos los estudiantes viven en el pueblo

Answers

La frase que es gramaticalmente incorrecta es "La familia Pérez asistirán a la obra de teatro".

¿Cómo identificar una oración incorrecta?En primer lugar una oración debe expresar una idea completa por lo que se debe verificar que la oración tenga un sujeto, un predicado y una idea completaEn segundo lugar, identifique que cada uno de los elementos sea gramaticalmente correcto. En este caso, "la familia Pérez asistirán" es incorrecto porque la familia es singular y el verbo "asistirán" es plural.

Nota: Esta pregunta está incompleta, aquí esta la parte restante:

Cual de estas es la oración INCORRECTA *

Casi todos los estudiantes viven en el pueblo.

La nueva costurera confeccionó los vestidos.

Ese árbol de hojas naranjas florecerá en abril.

La familia Pérez asistirán a la obra de teatro.

Aprenda más sobre oraciones en https://brainly.com/question/28325101

#SPJ1

Im bad at my spanish grammer so i just need that checked, plus anything that needs corrected gets corrected ALL VERBS MUST BE IN THE COMMAND FORM ingredientes
Dos tazas de azúcar
Uno taza de mantequilla
la mitad de taza de leche
Cuatro cucharas de chocolate en polvo
—————————————————————
Tres tazas de avena
Cuatro cucharas de mantequilla de maní
Dos cucharaditas de extracto de vainilla
Una olla
Algunas sartenes
___________________________________
Direcciónes
1•Revolva azúcar, mantequilla, leche, y chocolate en polvo y herva para uno minutó. (o cuando la mantequilla está derritído.)
2•quite la olla de la hornilla.
3•Añadir avenas, mantequilla de maní, extracto de vainilla en la olla.
4•Revolva.
5•Después, dejelo enfrie para treinta minutos.
6•Revolva y sace un poco de la mezcla en una sartén, en un bola
7•Repita muchas veces
8•Deje las galletas enfrie.
9•Después las galletas estén enfríon cómalas

(English translation of what it is supposed to be)
ingredients
Two cups of sugar
One cup of butter
half a cup of milk
Four tablespoons of chocolate powder
—————————————————————
Three cups of oatmeal
Four tablespoons of peanut butter
Two teaspoons vanilla extract
A pot
Some pans
___________________________________

Directions
1•Stir sugar, butter, milk, and chocolate powder and boil for one minute. (or when the butter is melted.)
2•Remove the pot from the burner.
3•Add oatmeal, peanut butter, vanilla extract in the pot.
4•Stir.
5•Then let it cool for thirty minutes.
6•Stir and remove some of the mixture in a pan, in a ball
7•Repeat many times
8•Let cookies cool.
9•After the cookies are cool eat them.

Answers

Answer:

Explanation:

Direcciones:

Revuelva azúcar, mantequilla, leche y chocolate en polvo y hierva unos minutos (o cuando la mantequilla este derretida.Quite la olla de la hornillaAñada en la olla avena, mantequilla de maní y extracto de vainilla.RevuelvaDespués, déjela enfriar por treinta minutos.Revuelva y saque un poco de la mezcla en un sartén, en forma de bola,Repita muchas veces.Deje que las galletas se enfríen.Cómalas una vez que las galletas estén frías.

Según la tabla, ¿cuál de las siguientes afirmaciones refleja mejor las coincidencias entre las definiciones de ética de la real academia española y leonardo boff?.

Answers

The best reflection of similarities between the definitions of ethics by the Real Academia Española and Leonardo Boff is that both emphasize moral values and conduct.

What common aspect is highlighted in the definitions of ethics by the Real Academia Española and Leonardo Boff?

When examining the definitions of ethics provided by the Real Academia Española and Leonardo Boff, a significant similarity becomes apparent. Both definitions place a strong emphasis on the importance of moral values and conduct.

The Real Academia Española defines ethics as the "science of moral duties and values that regulate human behavior," while Leonardo Boff's definition portrays ethics as the "reflection on the values and norms that guide human behavior in society." In essence, both definitions acknowledge the fundamental role of ethics in shaping human actions and promoting virtuous behavior.

They both recognize that ethical principles and values serve as guidelines for individuals to navigate their moral responsibilities within society.

Learn more about  ethics

brainly.com/question/26273329

#SPJ11

En los talleres literarios:
A. los participantes sugieren ideas para escribir.
B. los participantes siempre escriben textos en grupo.
C. los demás participantes corrigen lo que uno escribe.
OD. se juzga la calidad de los textos.

Answers

Answer:

Ф  A. Los participantes sugieren ideas para escribir.                      

Explanation:

- En los talleres literarios los participantes sugieren ideas para escribir.

...

Fill in the blanks with the correct form of the verbs in the present tenses given then translate

Correr=to run
Subjecto= ella

Answers

The sentences in the different tenses are ella corre (she runs), ella correrá (she will run), ella esta corriendo (she is running), etc.

How to conjugate a verb in different tenses?

In the Spanish language, each tense follows a pattern this depends on the subject. Therefore to conjugate a verb you will to know the structure of the tense and the subject. Based on this the sentences are:

ella corre (she runs)ella correrá (she will run)ella esta corriendo (she is running)ella estaba corriendo (she was running) ella corrió (she ran)ella corria (she used to run)corra (run)no corra (don't run)ella va a correr (she is going to run)si ella corre (if she runs)

Learn more about verbs in https://brainly.com/question/1946818

#SPJ1

7- Escribe un breve ensayo reflexivo basado en la lectura, teniendo en cuenta la estructura: Temas sugeridos: -Importancia de la familia. -La familia, célula básica del amor. -Mi rol dentro de la familia.​
Ayudaaaa porfaaaaaaaa

Answers

Answer: in English and Spainish

Explanation:

Compare the values for heat gain and heat loss in calculations 2 and 3. were they the same value? what might have caused the difference in values?

Answers

Answer:

Heat gain and heat loss are two important factors in calculating the energy efficiency of a building. In calculations 2 and 3, the values for heat gain and heat loss were not always the same. This difference could be caused by a number of factors.

One possible reason for the discrepancy is that different methods were used to calculate heat gain and heat loss in each calculation. For example, calculation 2 may have used a different formula or set of assumptions than calculation 3, leading to different results.

Another possible cause is that there were variations in the building's construction or operation between the two calculations. For instance, changes in insulation levels or HVAC system settings could affect how much heat is gained or lost through walls, windows, and other surfaces.

Overall, it's important to carefully consider all factors that could impact heat gain and loss when performing energy efficiency calculations. By doing so, we can ensure that our buildings are as efficient as possible and minimize their impact on the environment.

Explanation:

what is a key difference between the ideal self and the ought self?

Answers

Una diferencia clave entre el yo ideal y el yo obligado (ought self) es la naturaleza de las metas y expectativas asociadas con cada uno.

El yo ideal se refiere a la imagen o la versión idealizada de uno mismo que una persona aspira a ser. Representa las metas, valores y características que uno considera deseables y significativas en su vida. El yo ideal se basa en las aspiraciones personales y en cómo una persona se imagina a sí misma en su mejor versión.

Por otro lado, el yo obligado (ought self) se refiere a las expectativas y obligaciones que una persona siente que debe cumplir en función de las demandas sociales, las normas culturales y las expectativas externas. Estas expectativas pueden provenir de la familia, amigos, sociedad o cualquier otro contexto en el que la persona se encuentre inmersa. El yo obligado se centra en las responsabilidades y deberes percibidos, y en cómo una persona se siente obligada a comportarse o cumplir con ciertos roles y normas establecidas.

En resumen, mientras que el yo ideal se enfoca en las metas y valores personales, el yo obligado se centra en las expectativas externas y las obligaciones impuestas por la sociedad. Ambos conceptos pueden influir en la autoimagen y en cómo una persona se percibe a sí misma, pero se basan en diferentes fuentes de motivación y propósito.

fill in the blanks with the correct form of the verb in present tense ella (ver) una pelicula

Answers

Answer:

↔  ve.                          

Explanation:

⇔  Ella ve una película.                                      

...

Ven espiritu santo llena los corazones de tus fieles.

Answers

De acuerdo con la información, podemos inferir que la oración pertenece a la religión cristiana.

¿A qué religión pertenece la oración?

De acuerdo con la información, podemos inferir que la oración, "Ven Espíritu Santo, llena los corazones de tus fieles", pertenece a la religión cristiana.

Es una invocación dirigida al Espíritu Santo, que es una de las tres personas de la Santísima Trinidad en el cristianismo. La oración busca la presencia y acción del Espíritu Santo en la vida de los creyentes, pidiendo que llene sus corazones con su amor, sabiduría y guía divina.

Esta invocación es utilizada principalmente en la tradición católica durante momentos de adoración, oración y celebración litúrgica. También es común en otras denominaciones cristianas que reconocen la importancia y el papel del Espíritu Santo en la vida espiritual de los creyentes.

Nota: Esta pregunta está incompleta. Aquí está la información completa:
¿De qué religión es la siguiente oración?
Ven espíritu santo llena los corazones de tus fieles.

Aprenda más sobre religión en: https://brainly.com/question/11344302
#SPJ1

La humildad de la musica norteña huapango amor ranchero.

Answers

De acuerdo con la información, podemos inferir que la humildad es una característica presente en la música norteña, el huapango, el amor ranchero.

¿Es la humildad una característica de la música norteña?

La humildad es una cualidad que se puede apreciar en la música norteña, el huapango y el amor ranchero. Estos géneros musicales, originarios de diferentes regiones de México, se destacan por su sencillez, autenticidad y conexión con las experiencias y emociones humanas.

La música norteña, en particular, refleja la vida rural y la cultura de la gente del norte de México, donde la humildad y la sencillez son valores apreciados.

Aprenda más sobre música norteña en: https://brainly.com/question/2541259

#SPJ1

PLS ANSWER THIS QUESTION QUICKLY

Answers

The correct answer is the last one, some people were injured.

I hope this helps! :)

Answer:

Ф  Some people were injured.                                

Explanation:

Ф  Some people were injured.                        

...

Redacta un pequeño texto donde expreses tu opinión de ¿por qué a los jóvenes no les gusta leer?

Answers

Los Jovenes no quieren leer porque estan mucho en las redes sociales

TRUE/FALSE.Mirandé found that most of the men in his study had a positive view of the word macho and that Spanish speakers were more likely to have a positive view of macho than bilinguals.

Answers

False.

The statement is not accurate. Joe R. Feagin and Hernan Vera conducted a study in which they explored attitudes toward the word "macho" among Mexican-American men. In their book "The Agony of Education: Black Students at a White University," they discussed their findings. They found that the majority of the men in their study had a negative view of the word "macho." According to their research, many Mexican-American men associated the term with negative connotations such as violence, sexism, and aggressive behavior. This challenges the notion that most men had a positive view of the word.

It is also incorrect to claim that Spanish speakers were more likely to have a positive view of "macho" than bilinguals. Feagin and Vera did not make a specific comparison between Spanish speakers and bilingual individuals in terms of their attitudes toward "macho."

the development and testing of a complex intervention involves several phases. which phase involves an assessment of such issues as recruitment and retention

Answers

Answer:

The phase that involves an assessment of issues such as recruitment and retention in the development and testing of a complex intervention is typically referred to as the pilot phase or feasibility phase.

Explanation:

During this phase, the intervention is usually implemented on a smaller scale to evaluate its feasibility and gather valuable information before proceeding to a larger-scale study. The main objectives of this phase include assessing the feasibility of the intervention, determining the recruitment and retention strategies, identifying any barriers or challenges, and refining the intervention protocol based on the findings.

In terms of recruitment and retention, this phase aims to understand the effectiveness of the strategies employed to identify and enroll participants into the study, as well as the ability to retain them throughout the study period. It involves evaluating the methods used for participant recruitment (e.g., advertising, referrals, direct contact) and assessing the factors that influence participant engagement and retention (e.g., participant burden, motivation, intervention acceptability). The data collected during this phase helps inform the decision-making process for the subsequent phases of the intervention's development and testing.

Please help with this question!!

Answers

Answer:

 - Tenían fiebre.

Explanation:

- Tenían fiebre.

..

1-¿Qué significa Lorenzo Barquero en la vida de doña bárbara?

2-¿Por qué doña bárbara no le teme a la selva?​

Answers

En la novela Doña Bárbara, Lorenzo Baquero representa la parte sensible de Doña Bárbara y ella no le teme a la selva porque la conoce.

¿De qué se trata la novela Doña Bárbara?

Esta es una nóvela en la que el personaje principal es una mujer poderosa en Venezuela. En la misma aparece Lorenzo Barquero quien se enamora de Doña Bárbara y representa la sensibilidad de la misma la cuál empieza a tener sentimientos por Lorenzo.

Por otra parte, Doña Bárbara no le teme a la selva porque conoce y sabe manejar la naturaleza. Ella ha aprendido a adaptarse en situaciones difíciles y sobreviviría sin problemas en la selva.

Aprenda más sobre novelas en https://brainly.com/question/11204383

#SPJ1

Question 1 with 1 blank

yo / necesitar / usar / impresora / de Miguel / porque / mío / no / funcionar

1 of 1

Question 2 with 1 blank

pero / él / no poder / ayudarme / porque / suyo / tampoco / funcionar

1 of 1

Question 3 with 1 blank

me gustaría / pedirle / a Juana / su ratón, / pero / suyo / estar / descompuesto

1 of 1

Question 4 with 1 blank

yo / no poder / usar / teclado / de Valeria / porque / suyo / también / estar / descompuesto

1 of 1

Question 5 with 1 blank

si / yo / pedirte / computadora, / estar / seguro/a / de que / ir / decirme / que / no poder / usar / tuyo

1 of 1

Answers

Answer:

Explanation:

1- Yo necesito usar la impresora de Miguel porque la mía no funciona.

2 - Pero él no puede ayudarme porque la suya tampoco funciona.

3- Me gustaría pedirle a Juana su ratón pero el suyo está descompuesto.

4. Yo no puedo usar el teclado de Valeria porque el suyo también está descompuesto.

5. Si yo te pido tu computadora estoy seguro de que vas a decirme que no puedo usar la tuya.

...

does anyone know please help i’ll give so many points

Answers

Please show the question before so we can answer, thanks!

¿Qué papel desempeña la sirvienta en la vida de doña bárbara?​

Answers

De acuerdo con el texto podemos inferir que la sirvienta en la vida de Doña Bárbara desempeña un papel de confidente y apoyo emocional.

¿Qué papel desempeña la sirvienta en la vida de Doña Barbara?

De acuerdo con el texto podemos inferir que la sirvienta en la vida de Doña Bárbara desempeña un papel importante como confidente y apoyo emocional debido a que ella es testigo de las acciones y decisiones de Doña Bárbara, brindándole compañía y apoyo en momentos difíciles.

Adicionalmente, la sirvienta conoce íntimamente a Doña Bárbara y actúa como una figura cercana, con la que la protagonista puede compartir sus pensamientos y emociones más íntimos. A través de sus interacciones, la sirvienta ayuda a Doña Bárbara a reflexionar sobre sus acciones y a lidiar con sus propios conflictos internos.

Aprenda más sobre Doña Barbara en: https://brainly.com/question/15399113

#SPJ1

fill in the blanks with the correct form of the verb in present tense ella (ver) una pelicula

Answers

Answer:

Ella ve una película.

Explanation:

In the sentence "Ella ve una película," the verb "ver" is used in the present tense to match the subject "ella" (which means "she" in English).

In Spanish, the present tense form of the verb "ver" (meaning "to see" or "to watch") conjugates as follows:

Yo veo (I see/watch)

Tú ves (You see/watch)

Él/Ella/Usted ve (He/She/You formal see/watch)

Nosotros/Nosotras vemos (We see/watch)

Vosotros/Vosotras veis (You all see/watch)

Ellos/Ellas/Ustedes ven (They/You all see/watch)

Since the subject "ella" corresponds to the third person singular (he/she/you formal), we use "ve" as the present tense form of "ver" in this sentence.

So, "Ella ve una película" translates to "She watches a movie" or "She sees a movie" in English.

SOPA DE LETRAS! please help me find that picture!!

Answers

The missing word in this alphabet soup is plano, it is located in the p that is in the second column and the third row down.

How to solve an alphabet soup?

To solve a word search we must identify the words we must look for. Once we have done this step we must look for the letter with which the word begins to try to find it. In this case the words billete, motel, maleta, pasaporte y camping ya está señaladas. The missing word is plano.

This letter is found in the p that is in the second column and the third row down.

Learn more about alphabet soup in: https://brainly.com/question/4189664

#SPJ1

Delgada canadiense enamorado lista seguro enojada importante avergonzada.

Answers

Las palabras Canadiense, lista, importante se usan con ser, las palabras delgada, enamorado enojada, avergonzada se usan con estar y la palabra seguro puede utilizarse con ambas.

¿Cuándo utilizar ser o estar?

En general, ser se utiliza para estados que son permanentes. Por ejemplo, yo soy Canadiense o tu eres alto. Estos estados no cambiarán.

Por el contrario, estar se utiliza para estados que son permanentes o sujetos al cambio como las emociones. Por ejemplo, el esta enojado o ellos están cansados.

Nota: Esta pregunta está incompleta. Aquí esta la pregunta completa:

Ser o estar

Delgada

Canadiense

Enamorado

Lista

Seguro

Enojada

Importante

Avergonzada

Aprenda más sobre ser y estar en https://brainly.com/question/18857854

#SPJ1

Para ir al Alcázar de Colón desde el Obelisco Macho, sal del Obelisco a la Avenida George Washington, el Malecón. Sigue derecho cinco cuadras y dobla a la izquierda en la Avenida Duarte. Sigue derecho dos cuadras. No dobles en la Avenida Bolívar. Dobla a la derecha en la Avenida Mella. El Alcázar de Colón está en esa calle, a la derecha.

Answers

De acuerdo con la información, podemos inferir que la declaración sobre las indicaciones es falsa.

¿La declaración es falsa o verdadera?

De acuerdo con la información podemos inferir que el enunciado es falso. Según las instrucciones proporcionadas, se indica salir del Obelisco a la Avenida George Washington, que es la misma que el Malecón. No es necesario doblar en el Malecón después de la Avenida George Washington, ya que son la misma vía.

Por lo tanto, no hay una segunda vuelta mencionada en las instrucciones. Es importante leer y seguir cuidadosamente las indicaciones para asegurar una correcta navegación hacia el Alcázar de Colón desde el Obelisco Macho.

Nota: Esta pregunta está incompleta. Aquí está la información completa:

Your friend told you how to get to the Alcázar de Colón. Based on the directions, indicate if the statements are true or false.

Para ir al Alcázar de Colón desde el Obelisco Macho, sal del Obelisco a la Avenida George Washington, el Malecón. Sigue derecho cinco cuadras y dobla a la izquierda en la Avenida Duarte. Sigue derecho dos cuadras. No dobles en la Avenida Bolívar. Dobla a la derecha en la Avenida Mella. El Alcázar de Colón está en esa calle, a la derecha.

Primero, doblas en la Avenida George Washington y después en el Malecón.

Aprenda más sobre indicaciones en: https://brainly.com/question/31755485

#SPJ1

Brainliest if all answers are correct.

Use the recording to answer the questions: https://vocaroo.com/123hjuUojZVn

¿Dónde quiere ir el orador?

A. A Ecuador
B. a un lugar donde haya mucha pobreza
C. a un orfanato

¿Qué es importante para el orador?

A. sobrevivir
B. soñar
C. ayudar

¿Adónde fue su hermano?

A.a un orfanato
B. a un hospicio
C. a un hospital

¿Qué hizo su hermano en Ecuador?
A. Abandonó a los niños.
B. Sufrió de drogadicción.
C. Ayudó a enseñar y alimentar a los niños.

¿Qué quiere ser el orador?
A. ser voluntario
B. ser profesor
C. ser enfermero


Answers

Answer: Acording to the recording, the answers are:

1. B

2. C

3. A

4. C

5. A

Explanation: That's what's narrated in the recording.

De acuerdo con el audio, el orador quiere ir a un lugar donde haya mucha pobreza a ayudar así como lo hizo su hermano en un orfanato en el que ayudó a enseñar y alimentar a los niños como voluntario.

¿Cómo identificar las respuestas correctas?

Para identificar las respuestas correctas debemos escuchar el audio e identificar las opciones que expresan las ideas del orador. De acuerdo con lo anterior podemos inferir que las respuestas son:

1. El orador quiere ir a un lugar donde haya mucha pobreza.

2. El orador considera que lo más importante es ayudar a quienes lo necesitan.

3. El hermano del orador  fue a un orfanato a ayudar a los niños.

4. El hermano del orador ayudó a enseñar y alimentar a los niños del orfanato.

5. El orador quiere ser voluntario en un lugar en el que pueda ayudar.

Aprenda más sobre audio en: https://brainly.com/question/31845701

#SPJ1

la democracia es la forma de gobierno que mejor articula la libertad individual con la vida en sociedad​

Answers

La democracia es la forma de gobierno que mejor articula la libertad individual con la vida en sociedad debido a que tiene reglamentos que garantizan derechos y deberes para los ciudadanos.

¿Es la democracia la forma de gobierno más equilibrada?

La democracia es una forma de gobierno en la que los ciudadanos gobiernan de forma indirecta por medio de representantes (políticos) que defienden sus ideales en el gobierno. Esta forma de gobierno también tiene diferentes formar de crear y modificar leyes para que todos los ciudadanos tengan derechos y deberes en la sociedad.

Esto garantiza que haya mucha seguridad y bienestar para los ciudadanos. En este caso podemos inferir que la democracia es la forma de gobierno que mejor articula la libertad individual con la vida en sociedad.

Aprenda más sobre democracia en: https://brainly.com/question/12523740

#SPJ1

Necesito la metrica y si es arte mayor o menor, rima consonante o libre de la cancion hasta la raiz de Natalia Lafourcade.

I need the metric and if it is major or minor art, consonant or free rhyme of the song to the root of Natalia Lafourcade. ​

Answers

La canción "Hasta la raíz" de Natalia Lafourcade tiene una métrica constante de 8 sílabas por verso, lo que se conoce como octosílabo. En cuanto a la rima, utiliza una combinación de rima consonante y libre.

El esquema de rima de la canción es el siguiente:

Verso 1: A (consonante)

Verso 2: B (consonante)

Verso 3: A (consonante)

Verso 4: B (consonante)

Verso 5: C (libre)

Verso 6: C (libre)

Verso 7: D (libre)

Verso 8: D (libre)

La canción combina versos que riman consonantemente (A y B) con versos que no siguen una rima específica (C y D), lo que se conoce como rima libre. Esta combinación de rima consonante y libre le da un estilo único a la canción.

Según la fuente auditiva, ¿cuál de las siguientes frases describe mejor a américa latina?.

Answers

De acuerdo con la información de audio podemos inferir que la respuestas es que América Latina es una de las mayores riquezas ambientales del mundo (opción C).

¿Cómo identificar la opción correcta?

Para identificar la opción correcta debemos leer la transcripción del audio e identificar la información que se relaciona con los recursos naturales de América Latina. De acuerdo con lo anterior podemos inferir que el autor establece que América Latina es una de las mayores riquezas ambientales del mundo.

Por lo anterior, podemos establecer que opción correcta es América Latina es una de las mayores riquezas ambientales del mundo (opción C). Debido a que allí hay una gran biodiversidad y lugares naturales únicos.

Nota: Esta pregunta está incompleta. Aquí está la información completa:
Imagen anexada:

Transcripción del audio:

América Latina, una de las mayores riquezas ambientales del planeta. ¿Por qué? Por su diversidad de ecosistemas, desde la exuberante selva amazónica hasta los impresionantes arrecifes de coral. Su ubicación geográfica, entre océanos y montañas, crea condiciones ideales para la vida. La cultura latinoamericana valora y protege la naturaleza, mientras que los esfuerzos de conservación y la colaboración regional aseguran su preservación. Cuidemos este tesoro compartido.

Aprenda más sobre recursos naturales en: https://brainly.com/question/28619581

#SPJ1

What kinds of professional support and resources are avaiable to hispanics and latinos entering the technology fields at places like the illinois institute of technology and the massachusetts institute of technology? Answer in english please :)

Answers

Both the Illinois Institute of Technology (IIT) and the Massachusetts Institute of Technology (MIT) provide various professional support and resources for Hispanics and Latinos entering the technology fields. These resources aim to foster a supportive and inclusive environment while assisting students in their academic and professional journeys. Here are some examples:

Student Organizations and Networks: Both IIT and MIT have student organizations and networks dedicated to supporting Hispanic and Latino students. These groups provide a sense of community, mentorship, and networking opportunities.

Diversity and Inclusion Initiatives: Both institutions prioritize diversity and inclusion, and they have specific programs and initiatives to support underrepresented students, including Hispanics and Latinos. These initiatives often include mentorship programs, leadership development, and resources for academic success.

Academic Advising: Academic advisors at IIT and MIT can provide guidance and support tailored to the needs of Hispanic and Latino students. They can assist with course selection, academic planning, and connecting students with relevant resources.

Career Services: Career service offices at both institutions offer assistance with career exploration, internships, and job placement. They may organize career fairs, networking events, and workshops focused on helping Hispanic and Latino students succeed in the technology industry.

Scholarships and Financial Aid: Both IIT and MIT offer scholarships and financial aid programs to support students from diverse backgrounds, including Hispanics and Latinos. These opportunities can help alleviate financial burdens and provide access to resources needed for success.

Cultural Centers and Events: IIT and MIT often have cultural centers or multicultural offices that celebrate diversity and host events promoting cultural awareness and engagement. These spaces provide opportunities for Hispanic and Latino students to connect, share experiences, and learn from one another.

Listen to the audioand select the sport described.

A. el yoga
B. el tenis
C. el fútbol
D. el golf

Answers

Answer:

El fútbol no es solo un juego, es una pasión que une a personas de todos los ámbitos de la vida. Reúne a personas de diferentes culturas y orígenes, creando un sentido de comunidad y pertenencia. El fútbol no se trata solo de marcar goles o ganar partidos; nos enseña valores importantes como el trabajo en equipo, la disciplina, la perseverancia y el espíritu deportivo.

El fútbol tiene el poder de inspirar y motivar a las personas a lograr sus objetivos tanto en el campo como fuera del campo. Proporciona una oportunidad para que los jóvenes desarrollen sus habilidades físicas, habilidades sociales e inteligencia emocional.

Además, el fútbol se ha convertido en una industria multimillonaria que genera oportunidades de empleo para millones de personas en todo el mundo. Desde entrenadores hasta jugadores, desde árbitros hasta emisoras, el fútbol proporciona un medio de vida para muchos.

En conclusión, el fútbol es más que un juego; es una parte integral de nuestra cultura que trae alegría y emoción a millones de aficionados en todo el mundo. Por lo tanto, deberíamos seguir apoyando este hermoso deporte jugándolo nosotros mismos o simplemente disfrutando viendo competir a nuestros equipos favoritos.

Explanation:

Other Questions
list three axis powers A man is standing on the shore of a beach, up to his knees in water. Every 5 seconds a wave breaks on him. Calculate the period of the wave. A tennis ball is dropped from 1.0~m1.0 m, bounces off the ground, and rises to 0.85~m0.85 m. What kind of collision occurred between the ball and the ground a fairly common chronic inflammatory disease of the alimentary canal involving all layers of the bowel, which causes chronic diarrhea, is Sales area is a unique combination of _______, _______ and _______. a) sales area, distribution channel, division b) sales organization, plant, division c) sales organization, distribution channel, customer d) sales organization, plant, distribution channel e) sales organization, distribution channel, division Josie is excited to learn that a 5G network is being installed in her area. She recognizes that _____. a. this will increase mobile network latency b. the same antennas already in place for 4G can be reused without modification c. the 5G network will use more energy than the existing 4G network d. this will increase mobile data transfer speeds When is the ap computer science principles create task due 2022. What is the ideal mechanical advantage? if the resistance load is 45.2 n, estimate the effort force required to lift the load. if the effort is applied through a distance of 5 cm, how far will the resistance load move and in which direction? The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(hv^n) is highest. You may wish to use mixMarkov. Bill and Donald entered into a bet on the outcome of the next congressional election in their district. After the election, Bill, who bet on the winner, approached Donald, seeking to collect the $3,000 Donald had wagered. Donald paid Bill the wager but now seeks to recover the funds from Bill. Result? When Raul returns home in the late afternoon after three days of hiking and two nights of sleeping in a sleeping bag, he feels exhausted and immediately gets into his bed and sleeps until the next morning. How would the drive-reduction account of motivation explain Raul's behavior Plot diagram for the great gatsby Create a LunchOrder application that prompts the user for the number of hamburgers, salads, french fries, and sodas and then displays the total for the order. The LunchOrder application should include a: Assume that in humans there is a 50/50 chance that a child will be a boy. If a certain mother and father have four sons, what are the chances that their fifth child will be a daughter Check digits are the only type of validity check that is NOT able to validate data accuracy. Group of answer choices True False When one media company buys suppliers and/or distributors to create integration in the production and distribution of messages, there is: Group of answer choices de-regulation a vertical merger a horizontal merger a conglomerate merger Foodborne illnesses can be prevented by:A) washing hands and surfaces where food is prepared.B) eating home-canned food.C) storing food at room temperature.D) all of the aboveE) none of the above In an examination given to a class of 20 students, the following test scores were obtained. 35 45 50 50 55 60 60 75 75 80 80 85 85 85 85 90 95 95 95 100 (a) Find the mean (or average) score, the mode, and the median score. mean mode median (b) Which of these three measures of central tendency do you think is the least representative of the set of scores? mean mode median true/false. old age is revered in the united states and many other societies. These rays penetrate to the depths of food?A- Infrared RayB- Y-RayC- U.V. RayD- U.V. Ray and Y-Ray