A population of 752,000 people decreases at a rate of 1.4% each year. What will be the population after 18 years?

Answers

Answer 1

Answer:

562496

Step-by-step explanation:

i think

Answer 2

Answer:189504

Step-by-step explanation:

To get the 1.4% of population you need to multiply it like this: 752000 × 1.4% = 10528.

10528 is the population decrease every year, to find the population decrease after 18 years you need to multiply it again like this: 10528 × 18 = 189504.

189504 is the population decrease after 18 years.


Related Questions

need help asap!!!!!!
Please and thank you!

Answers

Answer:i thing the anwser is 56

Step-by-step explanation:

PLEASE HELP!
Question 1: y is directly proportional to x. If y=5 when x is 25:
a) Find an equation for y in terms of x.
b) Use your equation from part a) to find y when x is 100.

Question 2:
y ∝ x and y=132 when x=10
a) Find the value of y when x=14.
b) Sketch the graph of this proportion for x>0 and mark two points on the line.

Answers

1) The value of an equation for y in terms of x is, y = 1/5x

And, y = 20 at x = 100

2) y = 184.8 , at x = 14

The value of an equation for y in terms of x is, y = 13.2x

Given that;

1) y is directly proportional to x.

2) y ∝ x and y=132 when x=10

Now, For 1;

1) Since, y is directly proportional to x.

Hence, We get;

y = kx

Plug y = 5 and x = 25

5 = 25k

k = 1/5

Hence, The value of an equation for y in terms of x is,

y = 1/5x

And, Plug x = 100,

y = 1/5 x 100

y = 20

2) Since,  y ∝ x and y=132 when x=10

y = kx

132 = 10k

k = 13.2

Hence, At x = 14;

y = 13.2 x 14

y = 184.8

Thus, The correct equation is,

y = 13.2x

Learn more about the proportion visit:

https://brainly.com/question/1496357

#SPJ1

Can someone please help me get this answer

Answers

Answer:

C. 15 + 18x ≥ 95

Step-by-step explanation:

Given: She has $15 saved so far

She earns $18.00 for each lawn she mows (each lawn she mows = x)

The inequality has to be greater or equal to $95.00, so she can have enough to buy a pair of shoes.

15 + 18x ≥ 95

. A thermometer shows a temperature of -4.5°C. A nearby thermometer shows a temperature of 3.5°C. Explain how absolute value can be used to decide which temperature is warmer.​

Answers

Answer:

Step-by-step explanation:

The concept of absolute value can be used to determine which temperature is warmer between -4.5°C and 3.5°C. Absolute value is a mathematical function that returns the magnitude, or distance, of a number from zero, regardless of whether the number is positive or negative. In other words, the absolute value of a number is always a positive number.

In this case, we can calculate the absolute value of each temperature as follows:

| -4.5°C | = 4.5°C

| 3.5°C | = 3.5°C

The absolute value of -4.5°C is 4.5°C, which is greater than the absolute value of 3.5°C, which is 3.5°C. This means that -4.5°C is further from zero than 3.5°C, and therefore it is a colder temperature. So, the temperature of 3.5°C is warmer than the temperature of -4.5°C.

Therefore, we can use the concept of absolute value to determine which temperature is warmer by comparing the absolute values of the temperatures. The temperature with the greater absolute value is farther from zero, and therefore colder, while the temperature with the smaller absolute value is closer to zero, and therefore warmer.

At the store you can buy a bag with red and green apples in it. If 60% of the bag is red apples and there are 36 red apples, how many total apples are in the bag?
Group of answer choices

A. 58

B. 60

C. 62

D. 54

Answers

There are 60 apples in the bag

How to calculate the total number of apples that is in the bag?

Let y represent the total number of apples that is in the bag

36/y= 60/100

cross multiply both sides

60y= 36×100
60y= 3600

Divide both sides by the coefficient of y which is 60

60y/60= 3600/60

y= 60

Hence the total number of apples in the bag is 60 apples

Read more on apples here

https://brainly.com/question/10150579

#SPJ1

add. write your answer in simplest form 7 1/4 +4 5/12

Answers

Therefore, the simplified sum of the expression 7 1/4 and 4 5/12 is 35/3 that is option D, 11 2/3.

What is expression?

In mathematics, an expression is a combination of symbols and/or numbers that represents a quantity or a mathematical relationship between quantities. Expressions can be simple or complex, and can involve arithmetic operations, algebraic operations, functions, and variables.

Here,

To add these mixed numbers, we need to first convert them to improper fractions with the same denominator:

7 1/4 = 28/4 + 1/4

= 29/4

4 5/12 = 48/12 + 5/12

= 53/12

Now, we can add the fractions:

=29/4 + 53/12

To find a common denominator, we can multiply the denominator of the first fraction by 3 and the denominator of the second fraction by 1:

29/4 × 3/3 = 87/12

53/12 × 1/1 = 53/12

Now we have the same denominator, so we can add the numerators:

87/12 + 53/12 = 140/12

We can simplify by dividing the numerator and denominator by their greatest common factor, which is 4:

140/12 ÷ 4/4 = 35/3

To know more about expression,

https://brainly.com/question/1859113

#SPJ1

The side lengths of a triangle are 3 meters,4 meters, and 5 meters, Suppose the side lengths are multiplied by 4. Describe the change in the perimeter

Answers

The change in the perimeter is:

= 36m

The side lengths of a triangle are 3 meters,4 meters, and 5 meters.

We have to find the perimeter of the triangle.

Now,

Perimeter of a triangle is sum of all sides.

We have the side's length are:

[tex]P_1[/tex] = 3 + 4 + 5 = 12 meters.

Now, In the second case we have to multiplied the side length by 4.

Side's length are:

3 = 3 × 4 = 12

4 = 4 × 4 = 16

5 = 4 × 5 = 20

Perimeter of a triangle is sum of all sides.

[tex]P_2[/tex] = 12 + 16 + 20

[tex]P_2[/tex] = 48 meters

Now, the change in the perimeter is:

[tex]P_2 - P_1[/tex] = 48 - 12 = 36m

Learn more about Triangle at:

https://brainly.com/question/2773823

#SPJ4

please help asap!! i need the help

Answers

Answer:

Step-by-step explanation:

angle L is 106 degrees

x= 2

angle LMK is 37 degrees

its equal, you can check by adding up all the angles to 360 degrees

Choose a Strategy. Ms. Jimenez earns $27,000 per year. She is paid weekly. She puts 8% of her salary in a retirement fund. How much money goes into this fund each week?

Answers

After answering the presented question, we may conclude that  expressions As a result, Ms. Jimenez contributes roughly $41.54 to her retirement fund each week.

what is expression ?

In mathematics, you can multiply, divide, add, or subtract. An expression is constructed as follows: Number, expression, and mathematical operator A mathematical expression (such as addition, subtraction, multiplication, or division) is made up of numbers, variables, and functions. It is possible to contrast expressions and phrases. An expression or algebraic expression is any mathematical statement that has variables, integers, and an arithmetic operation between them. For example, the phrase 4m + 5 has the terms 4m and 5, as well as the provided expression's variable m, all separated by the arithmetic sign +.

We need to do the following to figure out how much money Ms. Jimenez puts into her retirement fund each week:

Ms. Jimenez's yearly retirement fund contribution is calculated as follows:

8% of $27,000 = annual retirement fund contribution

= 0.08 x $27,000

= $2,160

To calculate the weekly retirement fund contribution, divide the yearly payment by the number of weeks in the year:

Contribution to a retirement fund on a weekly basis = Annual contribution to a retirement fund divided by the number of weeks in a year

= $2,160 / 52

≈ $41.54

As a result, Ms. Jimenez contributes roughly $41.54 to her retirement fund each week.

To know more about expressions visit :-

https://brainly.com/question/14083225

#SPJ1

pls help thx your the best

Answers

Answer:

(- 2, 16 )

Step-by-step explanation:

y = 8x + 32 → (1)

y = - 8x → (2)

substitute y = 8x + 32 into (2)

8x + 32 = - 8x ( add 8x to both sides )

16x + 32 = 0 ( subtract 32 from both sides )

16x = - 32 ( divide both sides by 16 )

x = - 2

substitute x = - 2 into either of the 2 equations and evaluate for y

substituting into (2)

y = - 8(- 2) = 16

solution is (- 2, 16 )

Type the correct answer in the box. Use numerals instead of words. If necessary, use / for the fraction bar. Jim is categorized as poor. Thus Jim’s daily income must be less than how much dollars? Jim must be earning less than dollars per day.

Answers

Jim's daily income must be less than $2 in order for him to be considered impoverished.

What is Income?

Income is an entity's ability to save and spend money during a given period of time, and it usually appears in terms of money. In principle, income can be hard to establish, and there may be variations depending on the field.

According to the World Bank's definition, there are two categories for impoverished people's salaries:

a) Moderate Poverty - A person is deemed to be in moderate poverty if their daily income is less than $2.

b) Extreme Poverty - While a person is deemed to be living in extreme poverty if they make less than 1.2 dollars per day.

Jim's daily wage must be less than $2 in order for him to be classified as impoverished.

To know more about income, visit:

https://brainly.com/question/30015447

#SPJ1

PLEASE HELP!!!!!!!!
The box plots below show attendance at a local movie theater and high school basketball games:

Two box plots shown. The top one is labeled Movies. Minimum at 60, Q1 at 65, median at 95, Q3 at 125, maximum at 150. The bottom box plot is labeled Basketball games. Minimum at 90, Q1 at 95, median at 125, Q3 at 145, maximum at 150. Which of the following best describes how to measure the spread of the data?

a. The IQR is a better measure of spread for movies than it is for basketball games.
b. The standard deviation is a better measure of spread for movies than it is for basketball games.
c. The IQR is the best measurement of spread for games and movies.
d. The standard deviation is the best measurement of spread for games and movies.

Answers

a) 'The IQR is a better measure of spread for movies than it is for basketball games' best describes how to measure the spread of the data

According to the information provided, the box plots for movies and basketball games indicate that both have the same range of attendance data, with a minimum of 60 and a maximum of 150. However, when comparing the interquartile ranges (IQRs) of the two box plots, it can be seen that the IQR for movies is smaller than the IQR for basketball games.

The IQR represents the middle 50% of the data, and the smaller IQR for movies suggests that the attendance data for movies is more closely clustered around the median than the attendance data for basketball games. Therefore, the IQR is a better measure of spread for movies than it is for basketball games, as it gives a more accurate representation of the variability of the data for movies.

To learn more about IQR here:

https://brainly.com/question/31207390

#SPJ1

Simplify with steps shown:(p²+17p+70)/9p³ +63p² * 3/p+10

Answers

The simplified formula is therefore [tex](p^2 + 31p - 140) / 9p^3 (p - 10)[/tex] as factor the first fraction's numerator and discover a shared denominator.

what is fraction ?

A fraction is a percentage of an entire amount or a ratio of two numbers. It is a means to express a numeric value that is neither a whole number nor an integer. The number at the top of a fraction is called the numerator, while the number at the bottom is called the denominator. The denominator is the entire amount of elements of the entirety or the ratio's divisor, while the numerator is the portion that makes up the entirety or ratio that is being evaluated.

given

We must factor the first fraction's numerator and discover a shared denominator for the two fractions in order to simplify this expression:

(p² + 17p + 70) / 9p³ + 63p² * 3 / (p + 10)

= (p + 10)(p + 7) / 9p³ + 189p² / (p + 10)

= (p + 10)(p + 7); 9p3 + 189p2; (p - 10)/(p + 10); (p - 10)

= 189p2(p - 10)/9p3(p + 7)/9p3(p + 10) (p - 10)

= [(p + 10)(p + 7) + 21p²(p - 10)] / 9p³(p - 10) (p - 10)

= [(p² + 31p - 140) / 9p³(p - 10)]

The simplified formula is therefore [tex](p^2 + 31p - 140) / 9p^3 (p - 10)[/tex] as factor the first fraction's numerator and discover a shared denominator.

To know more about fraction visit:

https://brainly.com/question/10354322

#SPJ1

Joe’s broker’s fee schedule is given in the table. Joes current portfolio is worth $50,000. He wants to purchase 50 shares of a company’s stock fir a purchase price of $15 per share.


Joe will need to pay a commission of _____.


The total amount charged by the broker will be ______.


Space 1: $7. 50, $5. 00, $1. 50

Space 2: $17. 50, $15. 50, $15. 0

Answers

Jow will need to pay a commision of $7.50. The total amount charged by the broker will be $17.50

Joes current portfolio is worth $50,000

A purchase price one share =  $15

He wants to purchase 50 shares of a company's stock

Using unitary method the cost of 50 shares would be,

C = 50 × 15

C = $750

Since his portfolio is less than $100000 the amount chanrged by the broker would be equal to the 1% commision plus fees per trade.

First we find the commision.

1 percent of $750

= 1/100 × 750

= $7.5

And the fees per trade = $10

So, the total amount charged by the broker = $10 + $7.5

                                                                     = $17.5

Learn more about the unitary method here:

https://brainly.com/question/28276953

#SPJ4

Find the complete question below.

A jeweler had a fixed amount of gold to make bracelets and necklaces. The amount of gold in each bracelet is 6 grams and the amount of gold in each necklace is 24 grams. The jeweler made a total of 16 bracelets and necklaces using 258 grams of gold. Determine the number of bracelets made and the number of necklaces made.

Answers

Using a system of equations, the number of bracelets made and the number of necklaces made are:

Bracelets = 7Necklaces = 9.

What is a system of equations?

A system of equations is two or more equations that can be solved simultaneously or at the same time.

Simultaneous equations can be solved concurrently.

Quantity of gold in each bracelet = 6 grams

Quantity of gold in each necklace = 24 grams

The total number of bracelets and necklaces made = 16

The total quantity of gold used in making the 16 pieces = 258 grams

Let the number of bracelets made = x

Let the number of necklaces made = y

Equations:

x + y = 16 ...Equation 1

6x + 24y = 258 ...Equation 2

Multiply Equation 1 by 6:

6x + 6y = 96 ...Equation 3

Subtract Equation 3 from Equation 2:

6x + 24y = 258

-

6x + 6y = 96

18y = 162

y = 9

x = 7 (16 - 9)

Learn more about simultaneous equations at https://brainly.com/question/26310043.

#SPJ1

PLEASEEE PLEASEEE HELP ITS THE LAST QUESTION HURRYYY

Answers

Answer: C Q

Step-by-step explanation:

You need to Use Q And C In algebra if thats what your going for. Hopefully this help's.

s^2-11s
Find the solution set for this equation and separate the two values with a comma

Answers

The solution set for this equation S^2-11s can be expressed as 0, 11.

How can the values for the equation be determined?

An equation is a mathematical statement that shows that two expressions are equal. It consists of two sides, a left-hand side (LHS) and a right-hand side (RHS), separated by an equal sign (=). The LHS and RHS can contain variables, constants, and mathematical operations such as addition, subtraction, multiplication, division, exponentiation, and so on. The purpose of an equation is to find the value(s) of the variable(s) that make the equation true.

Given that S^2-11s, which can be written as S^2-11s = 0 We can factor the expression on the left-hand side to get:

S(S-11) = 0

Then this  equation is satisfied when either S = 0 or S-11 = 0. Thus, the solution set is: S = {0, 11}

Learn more about equation at:

https://brainly.com/question/2972832

#SPJ1

Calculate the surface area of a cylinder below. Use 3.14 for π, round to the nearest tenth, and just enter the number, not the unit.

Answers

The surface area of the cylinder to the nearest tenth is 82.2 in²

What is surface area of cylinder?

A cylinder is a three-dimensional shape consisting of two parallel circular bases, joined by a curved surface.

The surface area of cylinder is expressed as;

A = 2πr(r+h) . Where r is the radius and h is the height of the cylinder.

A = 2 × 3.14 × 1.7( 1.7+6)

= 10.68× 7.7

= 82.2 in²( nearest tenth)

Therefore the surface area of the cylinder is 82.2

learn more about surface area of cylinder from

https://brainly.com/question/27440983

#SPJ1

when we have data with two quantitative variables, x and y. suppose the general trend changes direction (for example, increases and then decreases). suppose we would like to determine if there is a relationship between x and y, and if so, we wish to create a model that allows us to predict the expected value of y based on x. what is a good method to use?

Answers

Once you have information with two quantitative factors, x, and y, and you watch a common slant that changes heading, one good method to decide in case there's a relationship between x and y and to form a show that permits you to anticipate the anticipated esteem of y based on x is to utilize polynomial regression.

Polynomial relapse may be a sort of relapse investigation in which the relationship between the free variable (x) and the dependent variable (y) is modeled as an nth-degree polynomial. By fitting a polynomial work to the information, you'll be able to capture the common drift of the information even if it changes course and utilizes it. to foresee the anticipated esteem of y based on a given esteem of x.

polynomial relapse can be a valuable method to analyze and show information with a changing drift and give experiences into the relationship between x and y. 

To learn about polynomial regression visit:

https://brainly.com/question/28490882

#SPJ4

Please help!!! It would be highly appreciated!!!

Answers

Answer:

  -x⁵ +3x² +3x +C

Step-by-step explanation:

You want the indefinite integral of (-5x⁴ +6x +3).

Power rule

The power rule for integration is the reverse of the power rule for derivatives.

  [tex]\begin{array}{ll}\text{Derivative:}&\dfrac{d(x^n)}{dx}=n\cdot x^{n-1}\\\\\text{Integral:}&\displaystyle\int {x^n}\,dx=\dfrac{x^{n+1}}{n+1}\end{array}[/tex]

Application

An indefinite integral represents a family of functions, each with the same derivative. In general, they may differ by a constant. That constant is necessary to signify the functions that will have the given expression as their derivative.

  [tex]\displaystyle\int {(-5x^4+6x+3)}\,dx=-5\dfrac{x^{4+1}}{4+1}+6\dfrac{x^{1+1}}{1+1}+3\dfrac{x^{0+1}}{0+1}=\boxed{-x^5+3x^2+3x+C}[/tex]

We might choose to display data with a stemplot rather than a boxplot because a stem plot I. reveals the shape of the distribution.
II. is better for large datasets.
III. displays the actual data.

Answers

Statements I, II, and III are partially correct, but statement II needs to be corrected to indicate that stem plots are better for small to moderate-sized datasets.

We might choose to display data with a stem plot rather than a boxplot because:

Reveals the shape of the distribution.

Is better for small to moderate-sized datasets.

Displays the actual data.

A stem plot is a type of graph that shows the distribution of data by grouping the observations into stems and leaves.

It allows for the display of the actual data values, which is not possible in a boxplot.

Additionally, stem plots are particularly useful for small to moderate-sized datasets as they provide a detailed view of the distribution, allowing for the identification of patterns such as skewness, multimodality, and outliers.

On the other hand, boxplots are better for large datasets as they provide a more concise summary of the distribution, including information about the median, quartiles, and outliers, while still conveying information about the spread and shape of the distribution.

For similar questions on Stem Plot

https://brainly.com/question/23145174

#SPJ11

How many planes of symmetry does a right pyramid with an isosceles triangle base have?

Answers

A right pyramid with an isosceles triangle base has one plane of symmetry.

How many planes of symmetry does a right pyramid with an isosceles triangle base have?

A plane of symmetry is a plane that can be passed through an object such that the object is divided into two halves that are mirror images of each other.

In the case of a right pyramid with an isosceles triangle base, if a plane passes through the apex (the top point) of the pyramid and is perpendicular to the base, it will bisect the base into two halves that are mirror images of each other. This is the only plane of symmetry that exists for this particular pyramid.

Thus, the right pyramid with isosceles triangle base has one plane of symmetry.

Learn more about right pyramid here: https://brainly.com/question/27447393

#SPJ1

need help ASAP!!! Please help! I’m having trouble!

Answers

The Surface Area of wooden box is 432 inch².

We have,

length = 12 inch

width = 8 inch

Height = 6 inch

So, Surface Area of wooden box

= 2 (lw + wh + lh)

= 2 (96 + 48 + 72)

= 2 x 216

= 432 inch²

Learn more about Surface Area here:

https://brainly.com/question/29298005

#SPJ1

Question 85
The distance between the end of the water supply pipe and the sink should be how many times the diameter of the supply pipe?
a. 1-1/2
b. 2 c. 3
d. 4

Answers

The distance between the end of the water supply pipe and the sink should be 2 times the diameter of the supply pipe. Option B is the correct answer.

The distance between the end of the water supply pipe and the sink is determined by plumbing codes and standards to ensure safe and efficient water delivery.

The National Standard Plumbing Code requires a minimum distance of 2 times the diameter of the supply pipe between the end of the pipe and the nearest point of use, such as a faucet or sink.

This helps prevent any potential contamination from the supply pipe and ensures adequate flow and pressure for efficient operation.

Learn more about the diameter at

https://brainly.com/question/16938080

#SPJ4

Can someone please help me ASAP? It’s due tomorrow!! I will give brainliest if it’s correct

Answers

Yes, the given values (59, 61, 64, 67, 72) represent a sample of the heights (in inches) of seventh-grade boys. The five-number summary provides information about the distribution of the sample, including the minimum value (59), the lower quartile (Q1, which is 61), the median (64), the upper quartile (Q3, which is 67), and the maximum value (72).

Given a reduced echelon matrix in R3 onto iff for every vector b in R3, Ax = b has a solution iff every row of A has a pivot.
a. true b. false

Answers

Every vector b in R3, the equation Ax = b has a solution if every row of A has a pivot.

The statement is true.

True.

If a reduced echelon matrix in R3 is obtained by row operations from a matrix A, then the reduced echelon matrix is in row echelon form and is equivalent to the original matrix A.

If every row of A has a pivot, then every row has a leading non-zero entry in the row echelon form of A.

This means that each row of the row echelon form of A has a pivot, and so the matrix has full row rank.

The number of pivot columns in the reduced echelon matrix equals the row rank of A, which is also the same as the column rank of A.

Vector b in R3, the equation Ax = b has a solution if and only if b is a linear combination of the columns of A.

If A has full column rank, then the columns of A span the column space of A, which means that any vector in the column space can be expressed as a linear combination of the columns of A.

If every row of A has a pivot, then A has full row rank, full column rank, and the columns of A span R3.

For similar questions on Vector

https://brainly.com/question/28047791

#SPJ11

A small can of beans is 3 in. high with a 1 in. radius and sells for $1.49. Which can of beans is a better deal?

a. 9 in. high; 3 in. radius; sells for $39.95
b. 3 in. high; 2 in. radius; sells for $5.96
c. 3 in. high; 3 in. radius; sells for $13.41

Answers

Therefore, the can of beans that is the best deal is option b, which has the lowest price per unit volume.

What is volume?

Volume is a measure of the amount of space occupied by an object or a substance. It is often measured in cubic units such as cubic centimeters, cubic inches, or cubic meters. The formula for finding the volume of different objects may vary based on their shape and size, but it typically involves measuring the length, width, and height of the object and multiplying them together.

Here,

To determine which can of beans is the better deal, we need to compare their volumes and prices per unit volume.

The volume of the small can of beans is:

V₁ = πr₁²h₁

= π*(1)²*(3)

= 3π

The price per unit volume of the small can is:

P₁ = $1.49 / 3π

≈ $0.157 per cubic inch

For the other cans of beans, we can calculate their volumes and prices per unit volume:

a. V₂ = πr₂²h₂

= π*(3)²*(9)

= 81π

P₂ = $39.95 / 81π

≈ $0.155 per cubic inch

b. V₃ = πr₃²h₃

= π*(2)²*(3)

= 12π

P₃ = $5.96 / 12π

≈ $0.132 per cubic inch

c. V₄ = πr₄²h₄

= π*(3)²*(3)

=27π

P₄ = $13.41 / 27π

≈ $0.165 per cubic inch

To know more about volume,

https://brainly.com/question/28338582

#SPJ1

The perimeter of a rectangular living room is 38 meters. The living room is 9 meters wide how long is it

Answers

If the perimeter of a rectangular living room is 38 meters, the length of the living room is 105 meters.

The perimeter of a rectangle is the sum of the lengths of all its sides. Let's denote the length of the living room as "L". The formula for the perimeter of a rectangle is:

Perimeter = 2(length + width)

We know that the width of the living room is 9 meters, and the perimeter is 38 meters. Substituting these values in the formula, we get:

38 = 2(L + 9)

Dividing both sides by 2, we get:

19 = L + 9

Subtracting 9 from both sides, we get:

L = 105

To learn more about perimeter click on,

https://brainly.com/question/13203351

#SPJ4

A teacher was interested in the subject that students preferred in a particular school. He gathered data from a random sample of 100 students in the school and wanted to create an appropriate graphical representation for the data.

Which graphical representation would be best for his data?

Stem-and-leaf plot
Histogram
Circle graph
Box plot

Answers

The circle graph would be the best graphical representation for the given scenario as it effectively shows the proportion of students who preferred each subject.

Which graphical representation would be best for his data?

For the given scenario where the teacher gathered data from a random sample of 100 students in a particular school and wants to represent the preferred subject of the students, the most appropriate graphical representation would be a circle graph or a pie chart.

A circle graph is a circular chart that is divided into sectors, where each sector represents a portion of the whole.

In this case, each sector can represent the percentage or number of students who preferred a particular subject. The circle graph is suitable when we want to show the proportion of different categories or data that add up to a whole.

On the other hand, a stem-and-leaf plot, histogram, and box plot are usually used to represent quantitative data, such as measures of central tendency (mean, median, mode), range, and distribution.

They are not ideal for categorical data like the preferred subject of students.

Read more about graphical representation at

https://brainly.com/question/28350999

#SPJ1

joseph earned a score of 516 on exam a that had a mean of 600 and a standard deviation of 40. he is about to take exam b that has a mean of 76 and a standard deviation of 20. how well must joseph score on exam b in order to do equivalently well as he did on exam a? assume that scores on each exam are normally distributed.

Answers

Joseph must score at least 32 on exam B to do equivalently well as he did on exam A.

To determine how well Joseph must score on exam B in order to do equivalently well as he did on exam A, we need to find the equivalent z-score for his exam A score and then use it to find the corresponding score on exam B.

First, we find the z-score for Joseph's exam A score:

z = (x - mu) / sigma

z = (516 - 600) / 40

z = -2.1

The z-score of -2.1 indicates that Joseph's exam A score is 2.1 standard deviations below the mean.

To find the equivalent score on exam B, we use the formula:

z = (x - mu) / sigma

Solving for x, we get:

x = z * sigma + mu

x = -2.1 * 20 + 76

x = 32

To learn more about standard deviations visit:

brainly.com/question/23907081

#SPJ11

Other Questions
Question 47 Marks: 1 General overall policy planning includes all of the following exceptChoose one answer. a. aspirations and realistic objectives b. detailed engineering and specific architectural project plans c. identification of goals d. establishment of functional priorities DNA can only be used as a code for making Try These questions out and Ill give you brainliest when your friend was admitted to a psychiatric hospital for severe depression, he became very close with other patients on the ward. in fact, he even referred to other patients as brothers and sisters. what type of family did he experience? Q3: What is and strength and weakness of the government OLIGARCHY? if you encounter a question on social media channels to which you dont have an answer, what is the best way to respond? A wealthy, sophisticated investor with a high risk tolerance has just turned extremely bearish on the market. To profit from this, the BEST recommendation to the client would be to:a. buy index callsb. buy index putsc. buy inverse floatersd. buy leveraged inverse ETFs which of the following statements about the internet is true? responses the internet is a computer network that uses proprietary communication protocols. the internet is a computer network that uses proprietary communication protocols. the internet is designed to scale to support an increasing number of users. the internet is designed to scale to support an increasing number of users. the internet requires all communications to use encryption protocols. the internet requires all communications to use encryption protocols. the internet uses a centralized system to determine how packets are routed. Developmental disabilities cannot be cured. truefalse addition of a sample of compound A to compound X does not lower the melting point of X, X must be identical to A? Each of the 10 firms in a competitive market has a cost function of C = 20 +22 The market demand function is Q420-p. Determine the equilibrium price, quantity per fim, and market quantity. The equilib rium price is $(Enter your response as a whole number) The quantity per fem is q=units. (Enter your response as a whole number) The market quantity is Q=units. (Enter your response as a whole number) Suppose the firm faces a price of $34, an average variable cost of $21, and has an average fixed cost of $5. In the short-run, this tim O A. can cover all its costs 8. cannot cover all its costs, a A. and will have a profit per unit of $13. OB. and will have a loss per unit of $13. OC. and will have a profit per unit of $8 D. and will have a loss per unit of $8. Question 9The factor used to determine the bromine residual with the chlorine test kit (DPD):a. multiply chlorine residual by 2.25b. multiply chlorine residual by 4c. divide chlorine residual by 4d. divide chlorine residual by 2.5 Find the volume of the cylinder in terms of . A. 154 cm3 B. 406 cm3 C. 539 cm3 D. 1078 cm3 According To the law of marginal diminishing return, if a variable factor input to a given amount of fixed factor is increased by a firm keeping the technology as constant, what will be observed about the marginal product of the variable input? A. Eventually it will decline B. It will constantly increase C. It will always remain same D. None of above a developmental task of middle adulthood is: developing leisure time activities coping with a partner's death preparing for one's own death learning to live with a partner What happens to the lieutenant who holds his wounded right arm carefully in his left hand? Which pricing objective is associated with the phrase "charging what the market will bear"?a.volume-orientedb.profit-orientedc.cash flowd.market demande.status quo You push with a steady force of 19 N on a 46-kg desk fitted with casters (wheels that swivel) on its four feet.How long does it take you to move the desk 5.1 m across a warehouse floor? Question 34Perhaps the most important determinant of the cancer-causing potential of asbestos is:a. the type of asbestos mineral to which one is exposedb. the physical properties of asbestosc. the chemical properties of asbestosd. the size of the asbestos fibers to which one is exposed please translate to genetic code:GACCAAAUGGUAGCUAACUUUUGCAAUUUUAGGUCAAGGUA