Can someone please look at this paragraph I have in Spanish and tell me if it makes sense? Or if there are any changes to be made could you help me? I really need help (pls don’t answer if you don’t know)

Can Someone Please Look At This Paragraph I Have In Spanish And Tell Me If It Makes Sense? Or If There

Answers

Answer 1

Answer:

Hi, there everything is fine

Explanation:


Related Questions

You are responding to a friend when he or she asks you come estas you respond muy bien gracias y

Answers

Answer:

friend: cóme estás (how are you)

me: muy bien gracias y (I am fine / very good and you)

Are you asking for the translation?

Enter the word that correctly completes the sentence.

El _____es un animal que podemos montar. Hay de muchos colores: blancos, cafés, negros, café con blanco. Este animal como pasto y hierba. Puede caminar y correr muy rápido.

Answers

amix estas describiendo un caballo, pone caballo  

El caballo es un animal que podemos montar

A Maria y Juan les _______________ la paella

Is it...
1. fascina
2. facinan

Which one is it? Please help

Answers

im pretty sure it’s 2. facinan

I believe it's 2 because "facinan" is plural and so is "les".

-Hope this helps

Read and then choose the option that best answers the question.
What formal command would you use with your professor for the verb limpiar?
Limpiamos
Limpian
Limpias
Limpie

Answers

I think it is limpie

Answer:

Limpie.

Explanation:

Limpie

HELP, IMMEDIATELY PLEASE !!!!

Answers

agregó = add
Mezcló = mix
Como = eat
Disfrutó = enjoy

Cuál es el tema central de la historia la madremonte y el origen del sol y la luna​

Answers

Answer:

La Madremonte, llamada también la Madreselva, es un personaje legendario del folclor colombiano, presente en diversas regiones como

1 - ESTUDIO FORMAL DEL ROMANCE "EL ENAMORADO Y LA MUERTE"
2 - Determinación del tema
Un sueño soñaba anoche soñito del alma mía,
soñaba con mis amores, que en mis brazos los tenía.
Vi entrar señora tan blanca, muy más que la nieve fría.
—¿Por dónde has entrado, amor? ¿Cómo has entrado, mi vida?
Las puertas están cerradas, ventanas y celosías.
—No soy el amor, amante: la Muerte que Dios te envía.
—¡Ay, Muerte tan rigurosa, déjame vivir un día!
—Un día no puede ser, una hora tienes de vida.

Muy deprisa se calzaba, más deprisa se vestía;
ya se va para la calle, en donde su amor vivía.

—¡Ábreme la puerta, blanca, ábreme la puerta, niña!
—¿Cómo te podré yo abrir si la ocasión no es venida?
Mi padre no fue al palacio, mi madre no está dormida.
—Si no me abres esta noche, ya no me abrirás, querida;
la Muerte me está buscando, junto a ti vida sería.
—Vete bajo la ventana donde labraba y cosía,
te echaré cordón de seda para que subas arriba,
y si el cordón no alcanzare, mis trenzas añadiría.

La fina seda se rompe; la muerte que allí venía:
—Vamos, el enamorado, que la hora ya está cumplida.


Answers

`Answer:

just trying to get some points

Explanation:

Hola, aquí ustedes también tiene moderadores¿? y si tienen quienes son¿? u':

Answers

Answer:

que yo sepa asta ahora no hay

Aun no hay creo, yo pienso ser una ya aplique :)

What is the representative animal of the Quechua culture?

llama

horse

goat

Answers

The llama is the representative animal

Answer:

Explanation:

llama

Which is the correct way to say "Luisa sees the tree."?


Luisa ve al árbol.

Luisa ve el árbol.

Luisa ve a árbol.

Luisa ve árbol.

Answers

Answer:

luisa ve el árbol.........

B. Luisa ve el árbol.

10) I.
for your call for the last two hours. (wait)​

Answers

Explanation:

What do you mean bro?

!!!

What are you trying to ask?


What is the most famous bullring in Spain?

Las ventas de Madrid

Monumental de Barcelona

Maestranza de Sevilla

Answers

Answer:

Plaza de toros de las ventas.

Answer:

Las ventas de Madrid

Explanation:

Las ventas de Madrid is the most famous bullring in Spain

Alguien resumame esto porfa:
En el año 2021 celebramos el bicentenario de la independencia, pues el 28 de julio de 1821 sucedió algo que conmociono al Perú y al continente: el general argentino Don José Francisco de San Martin proclamo nuestra independencia en una fiesta de gente fascinada y atónita, que veía el inicio de la caída del virreinato español, hasta entonces el mas poderoso de Sudamérica.

Años Atrás, en 1780, los sueños de libertad y justicia se iniciaron con la rebelión de José Gabriel Condorcanqui, Tupac Amaru II, cacique descendiente directo de los incas, quien, junto a su esposa Micaela Bastidas y miles de mestizos, indios y negros, se enfrento a los españoles, pero fue derrotado.

Luego a mediados de 1814 se realizaron otros intentos, como las juntas de los hermanos Angulo y Mateo Pumacahua, en el Cusco, y otras mas en Ayacucho y Arequipa, en las que también participaron mestizos, criollos e indios, las cuales fueron sometidas, La única junta no derrotada fue la de Buenos Aires; en Lima nunca se pudo formar porque la presencia realista era mas fuerte.

Don José Francisco de San Martin, un general argentino que soñaba con la libertad de América, elaboro un plan continental con una estrategia militar que incluía la campaña de liberación del Perú, para lograr la liberación completa de América Hispana y, así, evitar la amenaza de cualquier ataque desde la gran colonia española. San Martín desembarco en Paracas y se dirigió a Lima haciendo un alto en Pisco, acuartelándose en Huaura. El plan de San Martín era acorralar y tomar el complejo militar en Lima, pero para esto tenia que atacar por mar y tierra.

La independencia desde Lima no fue un triunfo militar; sino un triunfo de su gente La presencia realista estuvo hasta 1826, fecha en la que se rindieron en el Callao; pero el 28 de julio de 1821 empezó el nacimiento, en el que peruanos de todas las clases sociales dispusieron de sus recursos personales y materiales, con la colaboración de argentinos y chilenos venidos del Sur, que, como O'Higgins, habían vivido en Perú o conocían la importancia de la libertad de las naciones hermanas.

Answers

Answer:

Aunque el movimiento independentista se generalizó tras la toma de España por las fuerzas napoleónicas y el aislamiento de la misma de las colonias por parte de la armada británica, en Perú, ricos terratenientes y propietarios industriales y mineros, que fueron el principal motor impulsor del movimiento de liberación en otros países de América Latina, apoyaron predominantemente a España. Esto fue motivado tanto por las preocupaciones sobre los levantamientos de los nativos americanos, como el reciente levantamiento de Túpac Amaru II en 1780-1781, como por los intereses comerciales y la competencia con Chile y Argentina. Como resultado de este levantamiento en Huánuco en 1812 y Cuzco en 1814-1816, aunque apoyados por la ya independiente Buenos Aires, fueron reprimidos con relativa facilidad.

El punto de inflexión de la guerra llegó con la ofensiva contra el virreinato de las tropas del general José San Martín del sur (1820-1823) y del general Simón Bolívar del norte (1824). José San Martín, quien en 1818 cruzó los Andes desde Argentina y derrotó a un pequeño ejército de realistas en la batalla de Maipú, en 1820 cruzó el rumbo hacia el sur del Perú por vía marítima y tomó Lima, donde el 28 de julio de 1821 declaró la Independencia del Perú. Sin embargo, las hostilidades continuaron y los realistas fueron finalmente derrotados con la ayuda de las tropas de Bolívar en la Batalla de Ayacucho.

13. ¿Cómo puedes responder? ¿Qué hiciste en tu vacaciones? *
1.Yo fui a la playa y tomé el sol, nadé en el oceano
2.Yo fuiste a la playa y tomé el sol, nadé en el oceano
3.Yo fui a la playa y toméaria el sol, nade en el oceano

Answers

Answer: Yo fui a la playa y tomé el sol, nadé en el oceano

Explanation:

Answer:

1.Yo fui a la playa y tomé el sol, nadé en el oceano

Explanation:

1.Yo fui a la playa y tomé el sol, nadé en el oceano

Write the 3 informal "tu" commands

Answers

Answer:

tu

vos

usted

hope it helps!

Yo “Hable” “Coma” la cena and “Escriba” la carta

who ever gets this right i will brainlist

1. Which is the correct way to say, "I never go out with my sister."?


Nadie salgo con mi hermana nunca.

Nadie salgo con mi hermana.

No nunca salgo con mi hermana.

No salgo con mi hermana nunca.


2. Enter the word that correctly completes the sentence.

I don't know anything.

No sé______





















3. Which is the correct way to say, "I don’t like any vegetables."?


Ninguna verdura me gusta.

Alguna verdura me gusta.

Ninguno verdura me gusta.

Alguno verdura me gusta.

Answers

Answer:

No salgo con mi hermana nunca

No se nada

Ninguna verdura me gusta

Explanation:

Im from argentina  

Answer:

1.Which is the correct way to say, "I never go out with my sister."?

Answer: No salgo con mi hermana nunca.

2. Enter the word that correctly completes the sentence.

I don't know anything.

No sé______

Answer: No sé nada

3.Which is the correct way to say, "I don’t like any vegetables."?

Answer: Ninguna verdura me gusta.

These answer should be correct.  

hope this helps,

thank you

CHOOSE ALL THAT APPLY WILL CROWN BRAINLIEST

Answers

Following Certain expressions and verbs such as tener que, ir a, poder o gustar.
For impersonal commands

ayo, anyone needs help with some spanish homework? im spanish and i can easily talk on english, so, i can help with spanish stuff.

Answers

Answer:

Spanish traslation:

Hola, ¿Alguien que necesite ayuda con algunos deberes en español? Soy español y puedo hablar fácilmente en inglés, así que, puedo ayudar con cosas en español.

Explanation:

Item 4
Which is the correct way to say, “I go out to walk the dog.”?


Sale para caminar al perro.

Sales para caminar al perro.

Salo para caminar al perro.

Salgo para caminar al perro.





Enter a conjugation of tener to correctly complete the sentence.

Esta semana estamos muy ocupados. Mi amiga Roxana tiene que ir a la tienda el lunes. Rafael tiene que estudiar para su examen. Luis y Ana tienen que cocinar el jueves. Yo_____ que limpiar mi recámara.

Answers

Salgo para caminar al perro.
2. Yo tengo que limpiar mi recámara
Salgo para caminar al perro
Tengo...

19. What is the opposite of; despegar

aterrizar
atrezar
ateresar

Answers

Answer:

Aterrizar

Explanation:

Aterrizar.

The answer should be Aterrizar.

Enter a direct object pronoun to correctly complete the sentence.

Nico escribe cartas.

Nico _____escribe.

Answers

Answer:

I believe the answer is Nico las escribe.

Explanation:

Since cartas are plural and feminine (you can determine by the -a ending for the "gender" and the -s ending for singular and plural), the correct direct object pronoun is las. Let me know if you still need help!

You can easily identify the indirect object by answering the questions, To whom? or For whom? an action is done.
True or False.

Answers

Answer:

False

Explanation:

Because it referring to a subject of a sentence

Direct And Indirect Object Pronouns #1
Nosotros les decimos la verdad. = Nosotros
1.
decimos.
Yo siempre le doy amor. = Yo siempre 2.
doy.
Tú le mandas regalos. = Tú
3.
mandas.
Yo te doy un regalo. = Yo
4.
doy.
Ella nunca me presta su coche. = Ella nunca
5.
presta.
Yo les hablo español. = Yo
hablo.
Felipe siempre me sirve chiles. = Felipe siempre 7.
sirve.
Tío Antonio nos regala muchas bufandas. = Tío Antonio
8.
regala
Yo te presto mis lentes. = Yo
9.
presto.

Answers

8
Explanation: right

B. ¿Cuál de los siguientes personajes no pertenece al mundo de la ciencia ficción?
• Androide.
• Robot.
• Héroe.
• Oráculo.

ayuda

Answers

Answer:

Robot

Explanation:

Robot and heroe and android

Please help!! with Spanish!! ASAP.

Answers

1 a. Resuelve algunos problemas.
b. Aritmético.
c. Total.
d. Dejar una propina.

2. - Problema ends with letter A.
- Feminine.
- Masculine.

Hello, hope this helps you:)
hi thank you so much

6. La profesora es de Alemania; es

Need help with the rest also.

Answers

Answer:

7. Juan y yo no estamos enfermos , Maria esta enferma  

8.Mis amigos estan ocupados

12.Vendemos

13. Trabajamos

15. Gusta

Explanation:

don't know the rest

Answer:

6. La profesora es de Alemania; es amable.

7. Juan y yo no estamos enfermos. María esta enferma.

8. Mis amigos estan muy ocupados hoy.

9. Que hora es? (1:30) la una y treinta.

10. Son las siete y un cuarto.

11. Tienes ganas de comer? Si, tengo ganas de ir a un restaurante chino.

12. Venden Uds. frutas? No, aqui nosotros vendemos ropa.

13. Juan y yo trabajamos en la tienda.

14. Les encanta leer el periodico? No, a ellos les encanta los libros de misterio.

15. A mi me gustan las clases!

Explanation:

What does the underlined word mean in the following sentence?

Oigo de una peluquería muy buena cerca de aquí.

candy store
butcher shop
barber shop
jewelry store

Answers

Answer:

Barber Shop

Explanation:

The answer is: barber shop

¿Cual es la especie litararia a la que pertenece un cuento policial?,por que?

Answers

Answer: "Especie literaria" es un término utilizado en algunos países de América Latina (especialmente en Perú) para referirse a los géneros literarios. Esto quiere decir que cuando se habla de especies literarias se habla de los principales géneros: lírico, dramático y épico. La lírica es el género que expresa sentimientos a través de versos.

Explanation: así que respondo tu pregunta bebé, ¿puedo preguntarte algo?

Need help with Spanish 1 super easy worksheet (10 questions) yall pls HELPP ITS DUE IN 2H

Answers

1 c

2 d

3 a

4 b

5 c

6 c

7 b

8 d

9 d

10 c

Answer:

Explanation:

1. Esquio en las montañas

2. practican/la cancha

3. nada/la piscina

4. compras/centro comercial

5. cocino/casa

6. estudiamos/la biblioteca

7. Caminas/el parque

8. pasa/la playa

9. trabajo/las redes sociales

10. montamos/el campo

please help,thank you have a good day

Answers

Answer:

B. Son las nueve menos veinte

Explanation:

(a) son las diez menos veinte

english translation- it’s ten minus twenty
Other Questions
A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3) Activity: write 3 three sentence about the picture. use the correct forms of adjectives in your sentence What type of force are you exerting when you lie on a bed?A. Electric forceB. Magnetic forceC. CompressionD. Tension The first step in the control process is ________. A) setting the desired moralsB) measuring actual performanceC) comparing performance against expectations D) applying managerial control necesito informacin sobre doble toque en voleibol Pls help me answer this :,(What is the equation of the quadratic graph with a focus of (5, 6) and a directrix of y = -12? Does anyone know the answers with big ideas! In Act I, scene ii, Claudiuss mention of Fortinbras raises the issue of _____. the cause of King Hamlets death how Fortinbras is better than Hamlet an external threat to Denmark corruption in Denmarks government Research a modern-day pioneer who became famous for accomplishing something great or moving humanity forward. Someone like Albert Einstein, Orville and Wilbur Wright, or Walt Disney.Analyze and identify how this person maintained a youthful outlook and introduced energy and excitement into their life.Write a short paragraph on one of their great accomplishments, and why they were passionate enough to see it through. Share your short paragraph and a picture of the person on one of your social media pages. What kind of comments did you get from your post? Upload a screenshot of your post here. ng lc qu trnh truyn khi l g? Khi qu trnh truyn khi xyra, ng lc truyn khi xy ra nh th no ? Which best explains whether a triangle with side lengths 2 in., 5 in., and 4 in. is an acute triangle?The triangle is acute because 22 + 52 > 42.The triangle is acute because 2 + 4 > 5.The triangle is not acute because 22 + 42 < 52.The triangle is not acute because 22 < 42 + 52. Based on the short story Phaethon; pretend you are Phaethon in the afterlife, write a letter (at least two paragraphs)to your father telling him how you feel about having asked to ride his chariot.PLEASE NO LINKS!!! The figure below is made of 2 rectangular prisms.What is the volume of this figure? The perimeter of a rectangle is 58 inches and the area is 180 square inches. Find the dimensions of the rectangle. illings and collections between an Enterprise Fund and the General Fund A city uses an Enterprise Fund to provide electricity to its citizens and to its General Fund. A total of $50,000 was billed to the General Fund and collected 30 days later. Prepare the journal entries necessary to record these transactions, and label the fund(s) used. Note: Under the Fund column, select the appropriate fund in which the transaction is recorded (GF: General Fund or ISF: Internal Service Fund). If 5 + 2 root 3 / 7 + 4 root 3 = a - b root 3, find a and b.