Can you help me pick out these two answers for the questions using the cladogram please will mark brainlist and my AI can’t answer this question pleaseeee

Can You Help Me Pick Out These Two Answers For The Questions Using The Cladogram Please Will Mark Brainlist

Answers

Answer 1

The amniotic egg is a trait that separates amphibians from primates. The trait that separates rabbits and primates from crocodiles is eggs with shells. Rabbits and primates are mammals while crocodiles are reptiles.

The Amphibians are cold-blooded animals that spend part of their lives on land and some part in water. The primates on the other hand are warm-blooded animals and they produce milk(mammals). Species of monkeys, apes, and lemurs are some of the examples of primates.

The trait that is common in primates and rabbits is the presence of hair. The crocodiles on the other hand are different from them as they lay hard-shelled eggs which protect the inner portion of the egg and also allow gaseous exchange.

To learn more about primates refer to the link:

https://brainly.com/question/29031326

#SPJ1


Related Questions

Your mother asked you to put water soluble fertilizer around the roots of her prize winning rose bush. The following week, you noticed the leaves of her rose bush are beginning to turn yellow and wilt. In terms of tonicity and water movement, explain why the rose began to die after the addition of fertilizer. Bonus: What can you do to solve this problem

Answers

Answer/Explanation:

The water soluble fertilizer that was added created a hypertonic environment. Concentration of solute is higher around the plant cells thereby leading to the movement of water molecule away from the cells of the rose bush. This is why the rise bush began to wilt as the leaves turn yellow.

Solution:

Give the plants a reasonable amount of water to cause the solution to be isotonic. When the amount of fertilizer and water is relatively balanced, the plants would be able to utilize the fertilizer, feed well and grow well.

As atmospheric CO2 increases, the amount of CO2 dissolved in seawater is expected to increase as well. This produces more carbonic acid, which then dissociates into hydrogen ions and something else.

Answers

Answer:

(HCO3-) bicarbonate

Explanation:

Which of the following is not a way humans affect the Carbon Cycle?

a
Volcanic eruption which spew tons of carbon dioxide and other carbon rich gases into the air.
b
Conversion of forest and ecosystems into cities and other areas.
c
Burning of fossil fuels through transportation and industry.
d
Increase in farming and ranching of animals, which changes land use and produces Carbon rich gases.

Answers

Answer:

D or B

Explanation:

I think this is correct

hope this helps :)

1. Populations do not permanently remain at carrying capacity T/F

Answers

What’s the question

Hi i need help with this, it shouldnt be too hard.


Describe the difference between gene mutations and chromosomal mutations, including:

- What are they?

- How do they occur, including their types?

- When will they result in a change in the phenotype of offspring?

Answers

Explanation:

Genetic alternations include chromosomal abnormalities and gene mutations. Chromosomal abnormalities generally arise during cell division. ... Gene mutations are permanent changes in DNA gene sequence. They can arise during normal DNA replication or in response to environmental factors.

Answer:

When a gene mutation occurs, the nucleotides are in the wrong order which means the coded instructions are wrong and faulty proteins are made or control switches are changed. The body can't function as it should. Mutations can be inherited from one or both parents. They are present in the egg and/ or sperm cells.

What type of mutation can affect offspring?

The only mutations that matter to large-scale evolution are those that can be passed on to offspring. These occur in reproductive cells like eggs and sperm and are called germ line mutations. No change occurs in phenotype. Some mutations don't have any noticeable effect on the phenotype of an organism.

a butterfly has a long dash tube called dash

Answers

Answer:

cool what about it

Explanation:

Answer:

cool

Explanation:

HELP ME PLEASE ILL GIVE YOU POINTS AND BRAINLIEST

word bank :
methane
reemitted heat
reradiated heat
solar radiation
carbon dioxide

label the diagram

Answers

Answer:

A= Methane

B= Carbon Dioxide

C= Solar Radiation

D= reemitted heat

E = reradiated heat

Sauce me brainliest

Use the cladogram to answer the question. Which trait(s) does the salamander have?
Lancelet
(outgroup) Lamprey Tuna Salamander Turtle
Leopard
Hair
Amniotic e99
Four walking legs
Jaws
Vertebral column
amniotic edd and hair
vertebral column, jaws, and four walking legs
four walking legs only
vertebral column and jaws only

Answers

Answer:

everything plesiomorphic (ie ancestral) so 4 walking legs, jaws and vertebral column

Explanation:

What do these do ?Endocrine Glands, hormones :

A. Transports nutrients and oxygen to the body, removes waste

B. Sends chemical messages for growth, reproduction, and
: Kidneys, bla energy processes

C. Filters the blood to removes toxins, excess water, and other
wastes

D. Works with skeletal system to procide movement, helps
digest food, pump heart, and move blood through veins
temperature, detects stimuli fro

E. Produces sex cells (sperm and ovum), nurtures and protects growing fertilizer egg

F. Provides support and structure to the body, stores minerals, produces blood cells, works with muscular system for movement

Answers

Answer:

F. Provides support and structure to the body, stores minerals, produces blood cells, works with muscular system for movement

Answer this question
What does Plato mean when he says education should be a cure?

Answers

Answer:

Plato believes that education is an attempt to cure a mental illness instead of using  a medicine. he believes that this will help bring out their talents instead of keeping them inside.

Explanation:

hi guys so i have two pet frogs and yesterday my sister wanted to be a co owner of them she does nothing for them just takes pictures what should i tell her and she also wants to change their names to a name i dont like its my frog not hers and she wants it to be hers to and change the name what should i do

Answers

yes definitely tell her she cant co own if she doesnt care for them. you, the original owner, should be able to choose and keep their names..

Answer:

You should tell her that it is you frog, and Since you have two let her name one of the frogs that way she does not get upset or mad or  take turns with a frog like she gets a week and then you get it

trust me I am the oldest out of 4 kids so

Explanation

Hope this helps you

1. What is a biogeochemical cycle?
2. What drives, or powers, the water cycle?
3. What causes water to condense and form clouds?

Answers

Answer:

1. In ecology and Earth science, a biogeochemical  cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic and abiotic compartments of Earth.

2. The sun, which drives the water cycle, heats water in the oceans. Some of it evaporates as vapor into the air. Rising vapor cools and condenses into clouds.

3. Heated by sunshine, the ground heats the air just above it. That warmed air starts to rise because, when warm, it is lighter and less dense than the air around it. As it rises, its pressure and temperature drop causing water vapor to condense. ... The air cools as it rises, and eventually clouds form.

Explanation:

The energy of an object due to its temperature is called
a. Temperature Energy
b. Thermometer
c. Thermal Energy
d. Chemical Energy

Answers

Answer:

C. Thermal energy.

The energy of an object due to its temperature is called Thermal energy.

We can study DNA to trace the processes of evolution
A) True
B) False

Answers

Answer:

True

Explanation:

It's true because it wants to be true.

True because I learned this in school. Trust me :)

What are TWO methods that can be used by the villagers to catch fish in the river?

Answers

Answer:

Hand operation  

Hook and line

Explanation:

HELP ASAP PLS!

In the diagram below, which represents the male reproductive organs of the flower?







Structure A


Structure B


Structure C


Structure D

Answers

Answer:

C.

Explanation:

It's the stamens, they release the pollen which is a male reproductive cell in plants. Hope that helps!

Answer:

The answer is C)

Explanation:

Cells divide for _. (check all that apply!)

a
repair
b
reproduction
c
growth
d
carbohydrate synthesis

Answers

Answer:

a. repair

b. reproduction

c. growth

Explanation:

the answers would be a, b, and c. hope this helps!

Which of the following cellular components would be most sensitive to phospholipases?

The lipid bilayer
Cholesterol
Microfilaments

Answers

Answer:

cholesterol

Explanation:

it enhances Chlorophile in plants thus also deals in rate of photosynthesis

how do you prove the fact that green plant releases Oxygen gas in the process of photosynthesis explain the experiment.​

Answers

Conclusion: Formation of gas bubbles prove that oxygen is produced by the green plants during photosynthesis.

Answer:

Aim : To prove that oxygen is produced during photosynthesis

Procedure : Place water plant in a beaker containing pond water.

Cover the plant with short stemmed funnel.Invert the test tube full of water and cover the stem of the funnel.While placing the test tube, ensure that the level of the water in beaker is above the level of stem of funnel.Expose the apparatus to the sunlight.

After few hours, gas bubbles will form and collect in the test tube.Test the gas in the test tube.

A glowing splinter bursts into the flame shows the presence of oxygen.

Observation: Gas bubbles in a test tube.

Result: Presence of oxygen.

Conclusion: Formation of gas bubbles prove that oxygen is produced by the green plants

The order of the genes on a plant chromosome is A, B, C, where A and B are located 10 cM apart and B and C are located 3 cM apart. What is the probability that the trihybrid ABC/abc will produce any kind of recombinant gamete

Answers

Answer:

Double Crossing-over prob = 0.3% Simple Crossing-Over prob A-B = 9.7%Simple Crossing-Over prob B-C = 2.7%Total Crossing-Over prob = 12.7%

Explanation:

Available data:  

order of the genes on a plant chromosome is A, B, CA and B are located 10 cM apartB and C are located 3 cM apart

The genetic distance = recombination frequency x 100 expressed in map units (MU). One centiMorgan (cM) equals one map unit (MU).

We can use the provided map with the distances between genes to predict the occurrence of any kind of recombinant gamete.  

We know that there is a probability of a simple crossing over to occur between genes A and B, or between genes B and C. And we also know that there is a probability of double crossing-over occurrence.

We can get the probability of the double-crossing over by multiplying the recombination frequencies between A-B and B-C. So,

DCO prob = recombination frequency A-B x recombination frequency B-C

                 = 0.1  x  0.03 = 0.003 = 0.3%

DCO prob = 0.3%

According to this, we would expect to find

0.15% AbC0.15% aBc

Now we need to know what are the probabilities of getting a simple crossing-over, SCO. We already have the genetic distances between genes. 10 cM equals 0.1 of recombination frequency, and 3cM equals 0.03 of recombination frequency. However, we can not estimate the probabilities of simple crossing over using only this information, because this data is including the probabilities of the double crossing-over occurrence. So we need to substrate this percentage.    

SCO prob A-B = 0.1 - 0.003 = 0.097 = 9.7%

SCO prob A-B = 9.7%

we would expect to find

4.85% Abc4.85% aBC

SCO prob B-C = 0.03 - 0.003 = 0.027 = 2.7%

SCO prob B-C = 2.7%

we would expect to find

1.35% ABc1.35% abC

The total Crossing-over probability, TCO, is then the sum of all the crossing over probabilities,

TCO= SCO A-B + SCO B-C + DCO

TCO prob = 9.7% + 2.7% + 0.3%

TCO = 12.7%

Which best illustrates a result of natural selection? a bat that is born with a wing that is missing the web dark-colored hares living in a snowy area mosquitoes that transmit disease to humans giraffes having increasingly longer necks over time Mark this and return

Answers

Answer:

D) giraffes having increasingly longer necks over time

Explanation:

Which scenario describes a relationship of predator-prey?

Answers

Answer:

A tapeworm latches itself in the intestines of a rat, feeding off all the nutrients eaten by the rat.

Explanation:

Took the quiz enjoy your A+

Answer:

A polar bear catches a seal for dinner.

Explanation:

Don't listen to the other answer it is incorrect.

what is a reactant of photosynthesis

Answers

Reactants: sunlight, CO2, H2O
Products: glucose and O2

Answer:

water carbon dioxide and energy

the products are glucose and oxygen

Explanation:

What happens in an ad hominem persuasive technique? A limited number of options are presented. A person is attacked rather than an argument. Loaded language is used to appeal to emotions. A quick judgment is made without the use of evidence.

Answers

Answer: B

Explanation:edg2021

In an ad hominem persuasive technique a person is attacked rather than give an argument.

What is an ad hominem argument?

An ad hominem reasoning argument is a type of argumentation where its validity is not based on an attribute.

An ad hominem argument is fallacious because it does not involve verifiable information to be proved.

This type of argumentation occurs when one person is attacked based on feelings of prejudice and or fallacious commentaries.

In conclusion, a person is attacked rather than give an argument in an ad hominem persuasive technique.

Learn more about ad hominem arguments here:

https://brainly.com/question/7494599

What does it mean if a galaxy gives off light that has been shifted toward the red
end of the electromagnetic spectrum?

Answers

Answer: Redshift and blueshift describe how light shifts toward shorter or longer wavelengths as objects in space (such as stars or galaxies) move closer or farther away from us. ... When an object moves away from us, the light is shifted to the red end of the spectrum, as its wavelengths get longer.

Explanation:

es below carefully
Leaf A
Leaf B
Do not compare the size and colour of the leaves.
Based on the diagrams shown above,
state one similarity between Leaf A and Leaf B.​

Answers

Answer:

They both have a petiole

Explanation:

Leaf A and Leaf B both possess a petiole.

A petiole is the part of the leaf found beneath it which attached the leaf to a stem.

Observing both leaves, they both have this in common. Therefore, they are similar because they both have petiole.

Mitosis occurs in certain types of eukaryotic cells called:
A. Gametes
B. Somatic cells
C. Sex cells
D. Egg and sperm cell

Answers

Answer: somatic cells

Explanation: the other three don’t cause mitosis, instead cause meiosis

Why do you think that it is important for health care workers to have corona virus vaccine?

Answers

Yes, I think it is essential for health care workers to receive the coronavirus vaccine. Health care workers, such as doctors and nurses, help patients with and without the virus. I believe that all health care workers should be vaccinated for their own health and their patients' health.

If two-parent with AB blood group claim and say that they have a baby with O blood group is born to them and it is their own baby and not adopted. Do you think they are speaking the truth?

Answers

I’m not sure that’s hard ask ur mom lol

The five factors that are common characteristics of living things include cellular composition, reproduction, response and adaptation, metabolism, and what?

A. diversity
B. systems
C. evolution
D. Phylogenetics

Answers

Answer:

option C is answer evolution

Five factors are common characteristics of organism reproduction, reaction and adaptation, metabolism, and evolution.

What are the five characteristics of living things?

Big idea: All living things share certain properties such as tissue, fertility, growth and development, energy expenditure, homeostasis, response to the environment, and adaptability.

What are the characteristics of living things?

Organisms have many characteristics of different pronunciations. They breathe, move, respond to stimuli, breed, grow and depend on the environment.

Learn about 5 factors that are common characteristics of living things at

https://brainly.com/question/24394893

#SPJ2

Other Questions
A force F of 10 N is applied in the direction indicated, per meter depth (into page). The 300 mm long triangular beam is Aluminum, 1100 series, and extends 2 meters into the page. What is the moment about point A, per meter of depth? The system is on Earth, at sea level, gravity acts in the direction of F.Note: The centroid of a triangle is located at h/3.A) 16 Nm/mB) 19 Nm/mC) 24 Nm/mD) 27 Nm/m What is the measurement of N? it is common for a developer to hold back funds before making final payment to ensure that subcontractors perform all work completely. group startstrue or false a 75 year old patient is complaining of shortness of breath. vital signs are bp 160/88, p 130, and r 22 with crackles in the bases of the lungs. you should A client who is anticipating total hip replacement is considering autologous transfusion. When teaching this client about autologous transfusion, it is important to emphasize that?-It reduces the risk of mismatched blood-A hemoglobin level above 9.5 mg/dL is required-there is no need to test the blood for infectious diseases-Donations may be made every other day PWEEZ helpBased on the results of the second simulation, if 224 groups are formed, about how many of them would you expect to contain all girls? Round your answer to the nearest number of groups true/false. the number of levels of observed x-values must be equal to the order of the polynomial in x that you want to fit. If the Watson strand for a double stranded DNA is 5 ATGGTCATGGGTTCCAATGCA 3, what is the sequence of the Crick strand? Find the center of mass of a thin triangular plate bounded by the coordinate axes and the line x + y = 9 if (x,y) = x + y. A)x=2,y=2B) x=54,y=54C)x=98,y=98D)x=1,y=1 Assuming the medium fertility variant, which group of countries will have a decrease in population by 2100, compared to 2015 levels? Choose all that apply.1. Low-income countries2. Lower-middle-income countries3. Upper-middle-income countries4. None of the groups of countries will decrease. A triangle has a side lengths of 21 miles, 28 miles, and 35 miles. Is it a right triangle? Because prices change over time, costs reported for these accounts tend to differ among inventory cost methods A slender bar of mass m and the length l is resting on a smooth horizontal surface, and a horizontal force F is applied perpendicular to the bar at the A. If m = 0.5kg, l = 0.3m, and F = 1.2 N, calculate the magnitude of the acceleration of end B at the instant when F is applied. Present your answer in m/sec^2 . If three-estimate sensitivity analysis is used, an example for which the pessimistic estimate is probably the lowest value is ______________ . A. Alternative life B. Decision node C. First cost D. Replacement machine What are the trends at the individual bank level in the change in the HTM percentage of investments held for large banks from 2013 to 2018 (the period after which the change in regulation took place)? Solve and graph on number line. |6x-3| Which of the following is not a key function of state regulation affecting health insurers and HMOs?A) Licensure of insurers, HMOs and producersB) Plan compliance with Medicare Advantage network adequacy requirementsC) Premium review and approvalD) Consumer ProtectionsE) Financial SolvencyF) Market Conduct Which of the following statements best explains how the Fourteenth Amendment has been interpreted to enhance federal power?The Fourteenth Amendment gave Congress the right to regulate discrimination in statesThe Fourteenth Amendment gave Congress the power to nominate state governorsThe Fourteenth Amendment gave Congress the power to regulate school curriculumThe Fourteenth Amendment gave Congress the power to monitor and regulate voting booths what is the complete ionic equation for the reaction between Na2SO4 and CaCl2 In the diagram below, whatseason is the NorthernHemisphere experiencing whenEarth is in the position indicatedby X?O (A) Fall(B) SpringO (C) SummerO (D) WinterSUN