Find the zeros of the function. Enter the solutions from least to greatest.
f(x) = (x-10)^2-49

Answers

Answer 1

Answer:f(x) = (x-10)^2-49

f(x) = (x-10+7)(x-10-7)

f(x) = (x-3)(x-17)

The zeros of the function are 3 and 17.

Step-by-step explanation:


Related Questions

highest common factor of a² + ab and ab + b²​

Answers

[tex]a^2+ab=a(a+b)\\ab+b^2=b(a+b)[/tex]

Therefore

[tex]\text{hcf}(a^2+ab,ab+b^2)=a+b[/tex]

4+(1/5)[-10*(25-13-3)}÷(-5)]​

Answers

Answer:

7.6

Step by step explanation

Use the information above to answer the questions that follow.
2.2.1
2.2.2
2.2.3
2.2.4
sanitation in Johannesburg if a property is 175 m².
Write down, to the nearest ten cents and excluding VAT, the cost for
Calculate the cost for 4,1 ke sanitation in Cape Town before the increase.
Mr Jones lives in Johannesburg and Ms Brown lives in Cape Town. They
both own a property with an area of 550 m² and each was billed for 22 kl
sanitation.
Use the table above to determine the difference in the cost of sanitation
for the two properties.
Explain how the tariff system used in Johannesburg is beneficial to
home owners in terms of water usage.
(2)
(8)
(2)
[34]
mor
MO
ud.
0
0

Answers

Mr. Jones in Johannesburg is billed R9,767.12 and Ms. Brown in Cape Town is billed R680.24 for their respective properties.

From the provided information for Cape Town's sanitation tariffs:

0-4.2 kl: R16.03 per kl

Since 4.1 ke is equivalent to 4100 liters, which is less than 4.2 kl, we can use the tariff rate for the 0-4.2 kl range.

Cost for 4.1 ke of sanitation

= 4.1 ke x R16.03 per kl

= 4100 liters x R16.03 per kl

= R65.83

For Mr. Jones and Ms. Brown, who own properties with an area of 550 m² each and were billed for 22 kl of sanitation.

we need to determine the applicable tariff rate based on the property size and calculate the cost.

In Johannesburg, based on the provided information, the tariff rate for properties larger than 300 m² to 1,000 m² is R443.96.

Cost of sanitation for Mr. Jones in Johannesburg:

= 22 kl x R443.96 per kl

= R9,767.12

Cost of sanitation for Ms. Brown in Cape Town:

= 22 kl x R30.92 per kl = R680.24

Therefore, Mr. Jones in Johannesburg is billed R9,767.12 and Ms. Brown in Cape Town is billed R680.24 for their respective properties.

Learn more about VAT here:

https://brainly.com/question/20628016

#SPJ1

Find the area of a circle with radius,
r
= 42cm.
Give your answer rounded to 3 SF.

Answers

Answer:

5541.77 cm^2

Step-by-step explanation:

PLEASE HELP ASAP
ANSWE

Answers

Answer:

664 Square yards

Step-by-step explanation:

Surface area= 2lw+2lh+2hw

=2(17×6)+2(17×10)+2(10×6)

=2(102)+2(340)+2(120)

=204+340+120

=664 Square yards

PLEASE HELP MARKING AS BRAINLIST!

Answers

Hello :)

P(A) = 1/2

P(B) = 5 or greater = 5,6 => 2/6 = 1/3

P(A and B) = 1/2 x 1/3 = 1x1/2x3 = 1/6 ≈ 0.17

the answer is 0.17

Draw a box plot for each set of data. {65,92,74,61,55,35,88,99,97,100,96} Cost of MP3 Players ($)

Answers

A construction of the box-and-whisker plot representing the data set is shown below.

What is a box-and-whisker plot?

In Mathematics and Statistics, a box-and-whisker plot and it can be defined as a type of chart that can be used to graphically or visually represent the five-number summary of a data set with respect to locality, skewness, and spread.

Based on the data (information) provided above, the five-number summary for the given data set include the following:

Minimum (Min) = 35.First quartile (Q₁) = 61.Median (Med) = 88.Third quartile (Q₃) = 97.Maximum (Max) = 100.

In conclusion, we can logically deduce that the maximum number is 100 while the minimum number is 35, and the median is equal to 88.

Read more on boxplot here: brainly.com/question/29648407

#SPJ1

During a normal day, there are 782 passengers in average that
are late for their plane each day. However, during the
Christmas holidays, there are 1,835 passengers that are late for
their planes each day which caused delays of 14 planes. How
many more passengers are late for their planes in each day
during the Christmas holidays?

i picked 4th grade lol

Answers

During the Christmas holidays, there are 1,053 more passengers who are late for their planes each day compared to a normal day.

To solve this problem

Calculating the difference between the quantity of late passengers on a typical day and the quantity of late passengers on holidays is necessary.

1,835 travellers were late over the Christmas break.

On an average day, there are 782 travelers who are late.

Difference = Number of late passengers during the Christmas holidays - Number of late passengers on a normal day

Difference = 1,835 - 782

Difference = 1,053

Therefore, during the Christmas holidays, there are 1,053 more passengers who are late for their planes each day compared to a normal day.

Learn more about subtract here : brainly.com/question/30661244

#SPJ1

Answer:

Step-by-step explanation:

During the Christmas holidays, there is an increase of 1,053 passengers who are late for their planes each day compared to the average daily number of 782 passengers who are late. This surge in late passengers during the holiday period contributes to delays in 14 planes.

The higher volume of travelers, combined with potential factors like weather conditions, congestion, and heightened travel demand, likely leads to a greater number of individuals encountering delays and difficulties reaching their departure gates on time.


Hope it helps! :)

how to find the base area of a rectangular prism from length width and volume

Answers

If you want to find the base area of a rectangular prism, then all you need is length and width only.

[tex] \boxed{Volume = length \times width \times height} [/tex]

You don't need height. So, this is a must be easy.

[tex]\blue{\small{\mathfrak{That's \: it. \: Thanks \::)}}} [/tex]

The cost of 1kg potatoes and 2kg tomatoes was 30 on a certain day. After two days the cost of 2kg potatoes and 4kg tomatoes was found to be 66. ​

Answers



Let's represent the cost of 1kg of potatoes as 'p' and the cost of 1kg of tomatoes as 't'.

From the first statement, we know that:

1p + 2t = 30 (Equation 1)

From the second statement, we know that:

2p + 4t = 66 (Equation 2)

We can now solve this system of equations to find the values of 'p' and 't'.

Multiplying Equation 1 by 2, we get:

2p + 4t = 60 (Equation 3)

Now, we can subtract Equation 2 from Equation 3 to eliminate 'p':

(2p + 4t) - (2p + 4t) = 60 - 66

0 = -6

This implies that there is no consistent solution for the given system of equations.
Find the cost of 3kg potatoes and 3kg tomatoes on that day

The cost of 3kg potatoes and 3kg tomatoes on the day was 54.

The Tenorio Dairy makes cheese to supply to stores in its area. The dairy can make 250 pounds of cheese per day, and the demand at area stores is 180 pounds per day. Each time the dairy makes cheese, it costs $125 to set up the production process. The annual cost of carrying a pound cheese in a refrigerated storage area is $12. Determine the optimal size and the total annual inventory cost.

Answers

Answer:

The optimal size of each production run is 180 pounds, and the total annual inventory cost is $832,825.

Step-by-step explanation:

To determine the optimal size and total annual inventory cost, we need to consider the production capacity, demand, setup costs, and carrying costs.

Given:

Production capacity per day = 250 pounds

Demand per day = 180 pounds

Setup cost = $125

Carrying cost per pound per year = $12

First, let's calculate the optimal production size. We want to produce enough cheese to meet the demand without exceeding the production capacity.

Optimal production size per day = Minimum(Production capacity, Demand)

Optimal production size per day = Minimum(250 pounds, 180 pounds) = 180 pounds

Next, let's calculate the total annual inventory cost. This cost includes both the setup cost and the carrying cost.

Total annual inventory cost = (Setup cost * Number of setups per year) + (Carrying cost per pound * Optimal production size * Number of days in a year)

Number of setups per year = Number of production runs per year

Number of production runs per year = Total days in a year / Days per production run

Assuming a year has 365 days and each production run takes one day:

Number of production runs per year = 365 days / 1 day = 365 runs

Total annual inventory cost = ($125 * 365) + ($12 * 180 pounds * 365)

Total annual inventory cost = $45,625 + $787,200

Total annual inventory cost = $832,825

Help please, I need to get through geometry recovery class

Answers

To prove ∠AOW = 45°

Given,

∠WOZ = 90°

∠ZOB = 45°

Now,

∠XOA +∠AOW = 90°............(1)

∠XOA = ∠ZOB ( Vertically opposite angle  )

∠XOA = 45°

Substitute in (1),

45° +  45° = 90°

Now,

∠WOX = ∠XOA +∠WOA

So,

∠WOA + ∠WOZ + ∠ZOB = 180°( Linear pair )

∠WOA + 90° + 45° = 180°

∠WOA = 45°

Hence proved.

Know more about Lines,

https://brainly.com/question/15938035

#SPJ1

Snacknow, a food service firm, is calculating its monthly productivity report. From the following raw data calculate the labor, Multifactor, and Energy productivity.

Labor rate $10

Units produced 10,000

Labor hours 1,000

Cost of materials $2000

Cost of energy $500

Answers

The calculated productivities are:

Labor Productivity: 10 units per labor hour.

Multifactor Productivity: 0.8 units per dollar.

Energy Productivity: 20 units per dollar.

Answers to the aforementioned questions

To calculate the labor productivity, divide the units produced by the labor hours:

Labor Productivity = Units Produced / Labor Hours

Labor Productivity = 10,000 / 1,000 = 10 units per labor hour.

To calculate the multifactor productivity, divide the units produced by the sum of labor, material, and energy costs:

Multifactor Productivity = Units Produced / (Labor Cost + Material Cost + Energy Cost)

In this case, the labor cost is $10 per labor hour, so the labor cost is 1,000 labor hours * $10 = $10,000.

The material cost is $2,000, and the energy cost is $500.

Multifactor Productivity = 10,000 / ($10,000 + $2,000 + $500)

Multifactor Productivity = 10,000 / $12,500 = 0.8 units per dollar.

Finally, to calculate the energy productivity, divide the units produced by the energy cost:

Energy Productivity = Units Produced / Energy Cost

In this case, the units produced are 10,000, and the energy cost is $500.

Energy Productivity = 10,000 / $500 = 20 units per dollar.

Therefore, the calculated productivities are:

Labor Productivity: 10 units per labor hour.

Multifactor Productivity: 0.8 units per dollar.

Energy Productivity: 20 units per dollar.

Learn more about productivity at https://brainly.com/question/13532088

#SPJ1

Which of the following angles is not coterminal to
120°
A 180°
B. 240°
C. 840°
D. - 600°

Answers

C



Brainly needs this to be 20 characters long but it’s just c
C. 840° is not coterminal to 120°.

Function c
is defined by the equation c(n)=50+4n
. It gives the monthly cost, in dollars, of visiting a gym as a function of the number of visits, n
.

True or False? The inverse function is as follows:

n=(c(n) − 50)×4
Responses

Answers

Answer:

False

Step-by-step explanation:

1. The inverse function should have c(n) isolated
2. When finding the inverse of a function, the variables c(n) and n are interchanged (and then c(n) is isolated).
It would look like this --->c(n)=50+4n--->n=50+4(c(n)) ---> c(n)=(n-50)/4

PLSSS FIND BOTH x’s THANK YOUUU

Answers

Hello!

Solutions = -3 and 1.5

4. A machine depreciates by 40% in the first year, by 25% in the second year and by 10% per annum for the next three years. Each percentage being calculated on the diminishing value, what is the average percentage of depreciation for the entire period?​

Answers

Let's assume the original value of the machine is Rs. 100.
After the first year, the value of the machine depreciates by 40%, so its value becomes 60% of Rs. 100, or Rs. 60.
After the second year, the value of the machine depreciates by 25%, so its value becomes 75% of Rs. 60, or Rs. 45.
For the next three years, the value of the machine depreciates by 10% per annum, so its value becomes:
Year 3: 90% of Rs. 45, or Rs. 40.50
Year 4: 90% of Rs. 40.50, or Rs. 36.45
Year 5: 90% of Rs. 36.45, or Rs. 32.81
Therefore, the total depreciation over the five-year period is Rs. 100 - Rs. 32.81 = Rs. 67.19.
The average percentage of depreciation over the five-year period is:
(67.19 / 100) × 100 / 5 = 13.44%
Therefore, the average percentage of depreciation for the entire period is 13.44%

A normal distribution has a mean of 137 and a standard deviation of 6. Find the z-score for a data value of 155.

Round to two decimal places

Answers

Answer:

3

Step-by-step explanation:

To find the z-score for a data value of 155 in a normal distribution with a mean of 137 and a standard deviation of 6, you can use the formula:

z = (x - μ) / σ

where:

x is the data value,

μ is the mean, and

σ is the standard deviation.

Plugging in the values, we have:

z = (155 - 137) / 6

Calculating this expression:

z = 18 / 6 = 3

Music students and art students at a middle school were surveyed to choose a cardiovascular activity: playing sports or dancing.


Do you prefer dancing or playing sports?
Playing sports Dancing Row totals
Music students 32 15 47
Art students 31 22 53
Column totals 63 37 100


What is the marginal frequency of students who chose dancing?
15
22
37
53

Answers

The marginal frequency of students who chose dancing is 37.

The correct answer to the given question is option 3.

The marginal frequency of students who chose dancing can be calculated by adding up the number of students who chose dancing in each row or column. In this case, we need to add up the number of art students who chose dancing (22) and the number of music students who chose dancing (15), which gives us a total of 37. This is the marginal frequency of students who chose dancing.

Based on the survey results, it appears that a slightly higher percentage of art students prefer dancing (41.5%) compared to music students (31.9%). However, both groups of students seem to be fairly evenly split between dancing and playing sports, with a slight preference for playing sports overall.

It's worth noting that cardiovascular activity is important for overall health and well-being, and both dancing and playing sports can provide great opportunities for exercise and physical activity. Additionally, both activities can also be enjoyable and provide a sense of community and social connection, which is important for middle school students who are still developing their social skills and relationships. Ultimately, the choice between dancing and playing sports will depend on individual interests, preferences, and abilities.

For more such questions on frequency, click on:

https://brainly.com/question/254161

#SPJ8

How many significant digits are in 26.04813?​

Answers

7 significant figures.

Zeros that come at the start do not count as significant figures.

Eg. 0.0001 would only be 1 significant figure.

Zeros that come after is counted as a significant figure.

Eg. 2.20 Is three significant figures.

Alice was provided with the following trinomial: 3x² + 7x-12x - 34 - 2x² + 10 1 Provide Alice with a step-by-step guide on how to factorize the algebraic expression. ​

Answers

Hello!

[tex]3x^{2} + 7x-12x - 34 - 2x^{2} + 10\\\\3x^{2}- 2x^{2} + 7x-12x - 34 + 10\\\\x^{2} - 5x - 24\\\\x^{2} + 3x - 8x - 24\\\\(x^{2} + 3x) + (-8x - 24)\\\\x(x + 3) - 8(x + 3)\\\\\boxed{(x - 8)(x+3)}[/tex]

Give a rational Number between 4/7 and 6/11​

Answers

Hello!

4/7 = 44/77

6/11 = 42/77

42/77 < 43/77 < 44/77

the rationnal number between 4/7 and 6/11​ is 43/77

The demand for good X has been estimated by Qxd = 6 − 2Px + 5Py. Suppose that good X sells at $3 per unit and good Y sells for $2 per unit. Calculate the own price elasticity.

Answers

The own price elasticity of good X is -0.60, so we can conclude that good X is price inelastic.

What is the price elasticity?

The own price elasticity of good X is calculated using the formula:

Elasticity = (% Change in Quantity Demanded) / (% Change in Price)

Given the demand function for good X: Qxd = 6 - 2Px + 5Py, we can calculate the initial quantity demanded at a price of $3 per unit:

Qxd1 = 6 - 2(3) + 5(2)

= 6 - 6 + 10

= 10

The new quantity demanded when the price changes to $2.90 per unit:

[tex]Qxd_2[/tex] = 6 - 2(2.90) + 5(2)

[tex]Qxd_2[/tex] = 6 - 5.80 + 10

[tex]Qxd_2[/tex] = 10.20

Now, we can calculate the percentage change in quantity demanded:

% Change in Quantity Demanded = (Qxd2 - Qxd1) / Qxd1 * 100

% Change in Quantity Demanded = (10.20 - 10) / 10 * 100

% Change in Quantity Demanded = 0.20 / 10 * 100

% Change in Quantity Demanded = 2%

Next, we calculate the percentage change in price:

% Change in Price = (New Price - Old Price) / Old Price * 100

% Change in Price = (2.90 - 3) / 3 * 100

% Change in Price = -0.10 / 3 * 100

% Change in Price = -3.33%

The own price elasticity will be:

Elasticity = (% Change in Quantity Demanded) / (% Change in Price)

Elasticity = 2% / -3.33%

Elasticity ≈ -0.60

Learn more about price elasticity at: https://brainly.com/question/29615048

#SPJ1

Please help urgent thank you so much

Answers

Answer:  4, 14

Step-by-step explanation:

Bring everything over to other side that is not in the absolute value:

3 |x - 9| + 5 = 20                  >Subtract 5 from both sides

3 |x - 9| = 15                         >Divide both sides by 3

|x - 9| = 5                              >Create a positive and negative version to

                                                 drop the absolute value

x - 9 = 5                        x - 9 = -5

x= 14                                    x = 4

convert an effective rate of 14,5% per annum, to a nominal rate per annum compounded half yearly​

Answers

The nominal rate per annum compounded half-yearly, equivalent to an effective rate of 14.5% per annum, is approximately 14.900625%.

To convert an effective rate to a nominal rate compounded half-yearly, we can use the formula:

Nominal rate [tex]= (1 + r/m)^m - 1[/tex]

Where:

r = effective rate

m = number of compounding periods per year

In this case, the effective rate is 14.5% per annum, and we want to convert it to a nominal rate compounded half-yearly.

Since compounding is done semi-annually, m would be 2.

Plugging in the values:

Nominal rate [tex]= (1 + 0.145/2)^2 - 1[/tex]  

Simplifying the expression inside the parentheses:

Nominal rate [tex]= (1 + 0.0725)^2 - 1[/tex]

Calculating the exponent:

Nominal rate [tex]= (1.0725)^2-1[/tex]

Performing the calculations:

Nominal rate = 1.14900625 - 1

Nominal rate = 0.14900625

Converting the nominal rate to a percentage:

Nominal rate = 14.900625%

For similar question on nominal rate.

https://brainly.com/question/28971185  

#SPJ8

All else being equal, if you cut the sample size in half, how does this affect the margin of error when using the sam
to make a statistical inference about the mean of the normally distributed population from which it was drawn?
ME-
Z.S
O The margin of error is multiplied by √0.5.
O The margin of error is multiplied by √√2-
O The margin of error is multiplied by 0.5.
O The margin of error is multiplied by 2.

Answers

Answer:

When you cut the sample size in half while making a statistical inference about the mean of a normally distributed population, the effect on the margin of error depends on the relationship between the sample size and the margin of error. Generally, the margin of error is inversely proportional to the square root of the sample size.

So, if you reduce the sample size by half, it means you are taking a smaller sample, which will result in a larger margin of error. In other words, the margin of error is multiplied by a factor greater than 1.

Among the given options, the correct answer is:

D. The margin of error is multiplied by 2.

This option correctly reflects the relationship between reducing the sample size by half and the resulting increase in the margin of error.

The cost of a season train ticket is reduced by $33.10 which corresponds to a 10%
reduction. Find the original cost of the season ticket.

Answers

Answer:

Let's denote the original cost of the season train ticket as "x".

According to the given information, a reduction of $33.10 corresponds to a 10% reduction in the original cost. We can set up the following equation to represent this:

10% of x = $33.10

To solve for x, we need to convert 10% to decimal form, which is 0.10. We can rewrite the equation as:

0.10 * x = $33.10

Simplifying the equation, we have:

0.10x = $33.10

To isolate x, we divide both sides of the equation by 0.10:

x = $33.10 / 0.10

x = $331.00

Therefore, the original cost of the season train ticket is $331.00.

Step-by-step explanation:

Let X be the original cost of the season train ticket.
Then, we know that 10% of X is equal to $33.10.
We can write this as an equation:
0.1X = 33.10
To solve for X, we can divide both sides of the equation by 0.1:
X = 331.0
Therefore, the original cost of the season train ticket is $331.

simplify [tex]2x^{2} +10x\ x^{2}+2x-15[/tex]

Its a fraction

Answers

Answer: [tex]=\frac{2x}{x-3}[/tex]  

Step-by-step explanation:

 [tex]\frac{2x^{2} +10x}{x^{2} + 2x-15}[/tex]                        >Take out GCF(greatest common factor) on top

                                       >factor the bottom,  find 2 numbers that mulitply to

                                         "c" term, -15 and adds to the "b" term, +2

                                        >+5 and -3 mulitpy to -15 and add to +2

                                        > put +5 and -3 into factored form on bottom

[tex]=\frac{2x(x+5)}{(x-3)(x+5)}[/tex]                      >reduce the x+5 on top and bottom

[tex]=\frac{2x}{x-3}[/tex]                                >This is simplified

Directions: Below are hypotheses stated in different ways. Answer the following questions about each item.

a) In what form is the hypothesis stated?

b) Does it use a directional or non-directional test?

c) What level of measurement is each of the variables?

d) Convert the non-directional into directional.


1. The performance of the Staff Nurses is affected by their level of anxiety.

Answers

A. The hypothesis is stated in a correlational form.

B. It does not specify whether it uses a directional or non-directional test.

C. The level of measurement for these variables is not specified.

D. The higher the level of anxiety among Staff Nurses, the lower their performance.

What are the responses to other questions?

a. The hypothesis "The performance of the Staff Nurses is affected by their level of anxiety." is stated in a correlational form.

b) The given hypothesis does not specify whether it uses a directional or non-directional test.

c) The variables in this hypothesis are "performance of the Staff Nurses" and "level of anxiety." The level of measurement for these variables is not specified.

d) To convert the non-directional hypothesis into a directional one, we would need to specify the direction of the relationship between the variables. For example: "The higher the level of anxiety among Staff Nurses, the lower their performance."

learn more about hypothesis: https://brainly.com/question/606806

#SPJ9

find the general term of the arithmetic sequence if a8=8, a20=44

Answers

Answer:

[tex]a_n=3n-16[/tex]

Step-by-step explanation:

[tex]a_n=a_1+(n-1)d\\\\a_8=a_1+(8-1)d\rightarrow 8=a_1+7d\\a_{20}=a_1+(20-1)d\rightarrow 44=a_1+19d[/tex]

[tex]-36=-12d\\3=d[/tex]

[tex]8=a_1+7(3)\\8=a_1+21\\-13=a_1[/tex]

[tex]a_n=-13+(n-1)(3)\\a_n=-13+3n-3\\a_n=3n-16[/tex]

Other Questions
a fairly common chronic inflammatory disease of the alimentary canal involving all layers of the bowel, which causes chronic diarrhea, is Sales area is a unique combination of _______, _______ and _______. a) sales area, distribution channel, division b) sales organization, plant, division c) sales organization, distribution channel, customer d) sales organization, plant, distribution channel e) sales organization, distribution channel, division Josie is excited to learn that a 5G network is being installed in her area. She recognizes that _____. a. this will increase mobile network latency b. the same antennas already in place for 4G can be reused without modification c. the 5G network will use more energy than the existing 4G network d. this will increase mobile data transfer speeds When is the ap computer science principles create task due 2022. What is the ideal mechanical advantage? if the resistance load is 45.2 n, estimate the effort force required to lift the load. if the effort is applied through a distance of 5 cm, how far will the resistance load move and in which direction? The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(hv^n) is highest. You may wish to use mixMarkov. Bill and Donald entered into a bet on the outcome of the next congressional election in their district. After the election, Bill, who bet on the winner, approached Donald, seeking to collect the $3,000 Donald had wagered. Donald paid Bill the wager but now seeks to recover the funds from Bill. Result? When Raul returns home in the late afternoon after three days of hiking and two nights of sleeping in a sleeping bag, he feels exhausted and immediately gets into his bed and sleeps until the next morning. How would the drive-reduction account of motivation explain Raul's behavior Plot diagram for the great gatsby Create a LunchOrder application that prompts the user for the number of hamburgers, salads, french fries, and sodas and then displays the total for the order. The LunchOrder application should include a: Assume that in humans there is a 50/50 chance that a child will be a boy. If a certain mother and father have four sons, what are the chances that their fifth child will be a daughter Check digits are the only type of validity check that is NOT able to validate data accuracy. Group of answer choices True False When one media company buys suppliers and/or distributors to create integration in the production and distribution of messages, there is: Group of answer choices de-regulation a vertical merger a horizontal merger a conglomerate merger Foodborne illnesses can be prevented by:A) washing hands and surfaces where food is prepared.B) eating home-canned food.C) storing food at room temperature.D) all of the aboveE) none of the above In an examination given to a class of 20 students, the following test scores were obtained. 35 45 50 50 55 60 60 75 75 80 80 85 85 85 85 90 95 95 95 100 (a) Find the mean (or average) score, the mode, and the median score. mean mode median (b) Which of these three measures of central tendency do you think is the least representative of the set of scores? mean mode median true/false. old age is revered in the united states and many other societies. These rays penetrate to the depths of food?A- Infrared RayB- Y-RayC- U.V. RayD- U.V. Ray and Y-Ray A successful native advertising campaign is typically __________.A. DisruptiveB. Overlaid on top of site contentC. Designed to look like it belongs on the pageD. Seen only by consumers who opt-in On 7/1/Year 1, the Ish-U-Bonds Company issued bonds with a face amount of $1,000,000 due in 20 years. Coupons are paid semi-annually on December 31 and July 1, beginning 12/31/ Year 1. The annual coupon rate is 8%, and the annual market yield on the issuance day is 6%. What are the bonds issuance proceeds Which of the following is an advantage of group decision making?A. It is easy to execute because getting two or more managers to agree on a solution is relatively simple.B. It allows managers to take decisions within relatively short periods of time compared to individual decision makers. C, It allows managers to process more information and rectify one anothers errors.D. It is unaffected by any kind of cognitive bias as it benefits from multiple perspectives.