How do scientists use fossils to study climate?
PLS HELP

Answers

Answer 1

Answer:

Many small organisms can be preserved within these layers of sediment through time. The changing abundances of these fossils through time can tell us whether a change in the environment or climate was gradual or abrupt. Studying fossil pollen and other fossils helps scientists to learn more about climate change.

Answer 2

Answer:

How do scientists use fossils to study climate?

Answer=

Fossils are used by scientists to study climate.The changing abundances of these fossils through time can tell us whether a change in the environment or climate was gradual or abrupt. Studying fossil pollen and other fossils helps scientists to learn more about climate change.

 Hope it Helps

Bye...Mark me as Brainliest


Related Questions

SCIENCE ASSAP PLS
what does secondary succession mean in science

Answers

secondary succession is when plants and animals recolonize a habitat after a major ecological disturbance

Archie Carr helped save turtles from extinction. What did he do during Operation Green Turtle?
A.) He made laws against hunting turtles.
B.) He took turtle eggs to safe beaches.
C.) He cleaned the turtles after an oil spill.
D.) He planted grasses that turtles eat.

Answers

Answer:B

Explanation:The project distributed green turtle eggs and hatchlings to various nesting beaches around the Caribbean and the Gulf of Mexico in an effort to encourage the growth of their dwindling populations. His conservation efforts also led him to lead campaigns against ocean pollution.

list the planets from smallest to largest

Answers

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter

Explanation:

Answer:

Mercury, Mars, Venus, Earth, Neptune, Uranus, Saturn, and Jupiter.

Explanation:

hope this helps!!!:)

During cellular respiration, energy is transferred from *
1 point
A. ATP to glucose
B. CO2 to enzymes
c. sunlight to glucose
D. glucose to ATP

Answers

Answer:

a or b I'm sorry but I know it's not c

Answer:

A? im not sure..................

why is this conversion of energy from one molecule to another necessary for all cells?

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the energy conversion

=> ATP can be used to store energy for future reactions or be withdrawn to pay for reactions when energy is required by the cell.

=> When one phosphate group is removed by breaking a phosphoanhydride bond in a process called hydrolysis, energy is released, and ATP is converted to adenosine diphosphate (ADP).

Why do we care how strong a rock is?

Answers

Answer:

hahahahahahahaha

Explanation:

because

Answer:

to throw it at ur cheating bf

Explanation:

lma.o

  °   •  .°•    ✯

   ★ *     °      °·                            

.   • ° ★ •  ☄

▁▂▃▄▅▆▇▇▆▅▄▃▁▂

Why do we not use a Punnett Square to determine the offspring for asexual reproduction? Is that form of reproduction diverse? Explain your answer.

Answers

Answer: There isn’t another organism to cross with

Explanation:

In asexual reproduction there is only one parent so all the genes come from one person.

What are the two most common sources for rivers and streams?

Answers

Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:I did this in class 2 days ago LOL

Answer:

The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:

Hope this helped you :D

A child has a mass of 30 Kg on earth. If the gravity on the Moon is one sixth that of the earth what is the mass of the child moon

Answers

Answer:

30 kilograms

Explanation:

A change in gravity does not affect mass.

A student examines a periodic table.
Which inferences about sodium (Na) are true?

Answers

Answer:

true c this is the answer

Why do we want to produce genetically different organisms?

Answers

Answer: Genetically engineered crops produce higher yields, have a longer shelf life, are resistant to diseases and pests, and even taste better.

Explanation:

Everything I think produce organs I think

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answers

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

Multiple Choice
A student observed bees flying between flowers on a squash vine. after researching this activity, the student learns that bees obtain nectar from the flowers. The pollen from the flowers sticks to the bees and is transported to another flower of the same species, resulting in pollination. The student decides this is an example of mutualism. Which table explains why this relationship is mutualism?

Answers

Answer:

The answer is D

Explanation:

Flowers and bees both benefit from pollination so D

Answer: that should be d

Explanation:

Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion

Answers

Answer:

Secretion

Explanation:

Not completely sure tho, good luck

Are enzymes needed for metabolism?
A. YES!
B. NO!
C. MAYBE SO!

D. ALL OF THE ABOVE (This option clearly makes no sense! Don't pick it!)​

Answers

A.

Enzymes break down food

Answer:

YES! (Don't mean to yell, but those were the options.)

Explanation:

Enzymes break down food, and therefore, are needed for metabolism.

what happens to most solar radiation when it gets to earth??

Answers

Answer:

Most of the solar radiation is bounced off of earth´s atmosphere.

Explanation:

Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.

Type a paragraph describing how the circulatory and respiratory systems work together to deliver oxygen to the body’s tissues and remove carbon dioxide.
i. Include the names of structures and other components that play a role in gas
exchange.
ii. Explain how the interactions between the circulatory and respiratory systems
contribute to maintaining homeostasis in the body.
b) Type a second paragraph comparing the accuracy of your model to actual organ systems and
their functions.
i. Consider how a model is different from an actual human body.
ii. Describe the limitations of a model

Answers

Answer:

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in and out of the lungs through the trachea, bronchi, and bronchioles. Blood moves in and out of the lungs through the pulmonary arteries and veins that connect to the heart.

The circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

How circulatory and respiratory system work together?

The circulatory and respiratory systems work together to circulate blood and oxygen throughout the body. Air moves in to bring oxygen and out of the lungs to remove carbondioxde gas from the body. Blood moves into the lungs to bring carbondioxide gas and to load oxygen with the help of pumping of heart.

So we can conclude that circulatory and respiratory system work together to provide oxygen and remove carbondioxide gas.

Learn more about system here: https://brainly.com/question/14323743

The Moon completes one orbit around the Earth in approximately
in approximately
and completes one cycle of its phases
A 271/3 days, 24 hours
B 24 hours, 24 hours
C 24 hours, 29 1/2 days
D 27 1/3 days, 29 1/2 days

Answers

Answer:

Answer is D

Explanation:

Takes about then to circle the Earth

Answer:

It takes 27 days, 7 hours, and 43 minutes

Explanation:

How does natural selection lead to the evolution of a species?

Answers

Answer:

One of these is natural selection, which is a process that increases the frequency of advantageous gene variants, called alleles, in a population. Natural selection can result in organisms that are more likely to survive and reproduce and may eventually lead to speciation.

Explanation:

When a species evolves, it can get more repellent and tougher to what kills them off. For exp, if a animal can’t survive due to a carried disease, it will eventually evolve to be stronger against it.

What is the meaning of the term metabolism?

Answers

Metabolism is the chemical processes that occur within a living organism in order to maintain life. Have a good day! Also, any answer that says, ‘Here is the link to your answer: (link)’ DO NOT CLICK ON IT!!

2. Write the complementary DNA strand: (1 points)
CTT GAC TGA TGC

Answers

GAA CTG ACT ACG is the answer
GAA CTG ACT ACG
pretty sure this is right

Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.

Answers

Answer:

D. Meiosis ensures a wider variety of genetic variation.

This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.

What happens to chromosomes when an ovum and a sperm meet at fertilisation

Answers

Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.

Explanation:

A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong

Answers

A plant produces seed cones and pollen cones. Belong to plant group
phylum Coniferophyta and Yes it is vascular

A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.

What are gymnosperms?

Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.

Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.

Find out more about gymnosperms here.

https://brainly.com/question/15158870

#SPJ2

White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?

Answers

Answer:

Lysosome

Explanation:

scientific and common name for this?

Answers

Answer:

The common name for this is Moss

Scientific name is Bryophyta

Explanation:

Plzz help
Determine the proper number of chromosomes that would be found in a human cell at each stage of the cell cycle.

Answers

Answer:  The genetic material of the cell is duplicated during S phase of interphase just as it was with mitosis resulting in 46 chromosomes and 92 chromatids during Prophase I and Metaphase I. However, these chromosomes are not arranged in the same way as they were during mitosis.

Explanation:

Which of the following is true about the role of genetic and environmental factors in human health?
A) Genes are the only factor affecting whether or not an idividual will contract a disease.
B) Genetic factors are more important than environmental factors in determining an individual's
personal health risks.
C) Individuals can influence their health by controlling their genetic traits.
D) Environmental factors determine whether or not all genetic traits lead to health issues.
E) Certain environments can lead to an increased risk of developing certain diseases.

Answers

Answer:

E) Certain environments can lead to an increased risk of developing certain diseases.

Explanation:

The lesson states that specific environments can increase the chance of health problems.

I NEEEED HEEELP PLZZZZZZZZ :))

Answers

They would have black and white because grey shows up as lavender or blue in a chicken and it can’t be black or white because it says BW that is together so it would have to be black and white

Answer:

They would have both black and white feathers because codominance means that both genotypes have to be expressed. Gray isn't an apparent (given) trait.

What percentage of Americans use solar power ?

Answers

Answer:

66.7 percent.

Explanation:

I looked it up and nothing rly said what percentage of Americans use solar power but solar power was used for 2.30% of the total US electricity.
Other Questions
A map is drawn using a scale of 40 kilometers to 1 centimeter. The distance between two cities is 300 kilometers. How far apart are the two cities on the map? 3\5=6x=?\? i need help Louisiana Timber Company currently has 5 million shares of stock outstanding and will report earnings of $6.32 million in the current year. The company is considering the issuance of 1 million additional shares that will net $35 per share to the corporation. a. What is the immediate dilution potential for this new stock issue? What would this look like as a equation Three less than a variable Nuts berry farm makes their own trail mix using nuts and berries each pack of chair mix has 3 tablespoons of nuts and one tablespoon of berries into the percentage of the trail mix that is berries what kind of vote is used to decide the president !! Solve for x by factoring: x^2-30x+200=0 Should we ensure that the winner of the popular vote also wins the Electoral College? what was the main idea or motive for Romero britto how do forests help in maintaining global climate Please help.Algebra. Name the principle which states that energycannot be created or destroyed, merelytransferred from one form to another: Construct a circle through points X, Y and Z. What is the Voter Registration Act and how does it affect Gerrymandering? Name two Earth processes that influence the distribution of natural resources on Earth. A break or crack, in Earth's surface along which movement occursA. Rock CycleB. ExtinctionC. Ice CoreD. Fault what are the dangers of dark money? t-8=14??? Im literally annihilating You have previously chosen a side to an issue, stated a claim, and you have written ideas about your claim in your Argument Organizer. Now you will use your ideas from the organizer (and tips from this lesson) to write the introduction to your argument. Write three or more complete sentences. Remember to include: Overview: provide general information about your topic Explanation: describe why your issues is controversial Claim: present your stand on your issue that excludes all personal feelings and the pronoun I Independent practice1.a.2.Calculate the density p (in kg/m) for each of the following:m = 10 kg and V=10 m3b. m = 160 kg and V = 0.1 m3C. m = 220 kg and V = 0.02 m3A wooden post has a volume of 0.025 m' and a mass of 20 kg. Calculate itsdensity in kg/mChallenge. A rectangular concrete slab is 0.80 m long, 0.60 m wide and 0.04m thick. |Calculate its volume in m?,b. The mass of the concrete slab is 180 kg. Calculate its density in kg/m.3.a.