Immunocytochemical distribution of the cannabinoid CB1 receptor in the primate neocortex: A regional and laminar analysis

Answers

Answer 1

Analysis:

Delta-9-tetrahydrocannabinol (Delta9-THC) has a substantial influence on higher cognitive processes, and it has been linked to the emergence or worsening of clinical symptoms of schizophrenia.

These activities appear to be mediated through the CB1 receptor, which is the most abundant cannabinoid receptor in the brain.

However, the location of the CB1 receptor in monkey neocortical areas that influence cognitive activities remains unknown.

Using antibodies that selectively target the N- or C-terminus of the CB1 receptor, we studied the immunocytochemical localization of the CB1 receptor in the brains of macaque monkeys and humans.

In monkeys, CB1 immunoreactivity was most strong in axons and boutons. CB1-immunoreactive (IR) axons showed significant variation in density and  laminar distribution throughout neocortical areas of the monkey brain.

When compared to main sensory and motor cortices, neocortical association regions such as the prefrontal and cingulate cortices have a greater  density and a distinct laminar pattern of CB1-IR axons.

To learn more about Psychotic Disorders from the given link

https://brainly.com/question/939408

#SPJ4


Related Questions

With respect to normal base pairing, when a molecule of DNA replicates, thymine will most likely pair with 2 points

Answers

Answer: Adenine

Explanation:

The structure of the DNA double helix is complex in nature. There are two strands of DNA that are wound around each other. The nitrogenous bases are bonded with hydrogen bonding and base complementarity. According to the Chargaff's rule of base complementarity adenine always pairs with the thymine and guanine with cytosine. These nitrogenous bases are paired on the basis of hydrogen bonding. Adenine bonded with thymine through two hydrogen bonds whereas the cytosine pairs with guanine via three hydrogen bonds. During DNA denaturation these hydrogen bonds are broken whereas during DNA replication these hydrogen bonds are formed between the nitrogenous bases.

Put "Allele Frequency" in a sentence

Answers

Answer:

With this data we can built a map of allele frequency and geographic location.

Answer: Here are a variety of sentences you could use...

1. Jensen was born with blue eyes because each of his parents gave him a recessive allele for the trait.

2. The dominant allele is the one that determines a physical characteristic or trait.  

3. Because Jill’s parents both gave her the dominant allele for curly hair, she has a wavy hair texture.

4. Which allele is responsible for blonde hair, the recessive allele or the dominant allele?  

5. On the other hand, the recessive allele is always overshadowed by its dominant partner.  

what are the factors affecting brilliance of stars​

Answers

the age of the star because just like people as they grow older they become weak and so arr the stars their brilliance fade when they become older.

The intrinsic properties of stars include brightness, color, temperature, mass, and size. Three factors control the brightness of a star as seen from Earth: how big it is, how hot it is, and how far away it is.

Select the item(s) that describe a producer.

1.takes energy from the sun
2.helps rot dead organisms
3.fungus
4.tall grass
5.food is mostly animal
6.plant eater
multiple choice

Answers

Answer:

3. fungus

4. tall grass

5. food is mostly animal

Structure that display characteristic of living organisms only within living cells

Answers

this is the answer I hope it helps u

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Answers

CUGCUACAUCGUAGCUGGUAAC

Which feature is forming?

Oceanic crust
Continental
crust
Lithosphere
Lithosphere
Asthenosphere

Answers

Answer:

An island

Explanation:

for me i got it right

WILL GIVE BRAINLIEST!!

A magnetic globe is being held down on a base. When released, the globe rises above the base and eventually comes to rest floating above the base.

In which position shown does the globe have the greatest magnetic potential energy?

Answers

Answer:

Position 1 as the magnetic potential energy is waiting to be released when the hand moves.

Explanation:

Which of the following has to
occur in order for mammals to
create offspring?
A. fertilization
B. self-reproduction
C. mutation
D. self-fertilization

Answers

A. Fertilization, would be your answer

What is the strengths and weaknesses of the various developments in science and technology​

Answers

Answer:

Strengths, Weaknesses, Opportunities and Challenges ... Some have “ centres for research and development” while others ...

describe how acid precipitation affects ecosystems
will give brain crown thingy

Answers

Answer: Acid rain makes such waters more acidic, which results in more aluminum absorption from soil, which is carried into lakes and streams. Trees' leaves and needles are also harmed by acids... They are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife.

Explanation: YW <3

What type of material did the water most likely encounter when it stopped?

Answers

Answer:

Rocks

Explanation:

Rocks normally stop streams

what is a tumor and what does it have to do with mitosis
ASAP
will give brainliest

Answers

Answer:

Tumors constantly undergo mitosis.

Explanation:

Tumors are (generally) considered to be cancerous; therefore, they divide uncontrollably. Tumors undergo mitosis just like any other cell in your body but can be dangerous over time if not dealt with.

Answer:

What is cancer and what does it have to do with mitosis?

Cancer: mitosis out of control

Mitosis is closely controlled by the genes inside every cell. Sometimes this control can go wrong. If that happens in just a single cell, it can replicate itself to make new cells that are also out of control. These are cancer cells.

Explanation:

Forgive me if my answer is wrong and please give me BRAINLEST I really need them just give me 5 star rating to give me BRAINLEST

The total number of cells in an organism increases as a result of which process?
A respiration
B. photosynthesis
C cell division
D fermentation

Answers

Answer:

I am pretty sure that the answer is C.

Hopes this helps.

Have a great day!!!!!!!

It is fermentation... bc it’s the total number

Super easy. Please help

Answers

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

The effect of disorder of checkpoints proteins and cell cycle regulation
I need help!!!!!!???

Answers

Answer:

LEARNING OBJECTIVES

Identify important checkpoints in cell division

Explain how errors in cell division are related to cancer

The length of the cell cycle is highly variable, even within the cells of a single organism. In humans, the frequency of cell turnover ranges from a few hours in early embryonic development, to an average of two to five days for epithelial cells, and to an entire human lifetime spent in G0 by specialized cells, such as cortical neurons or cardiac muscle cells. There is also variation in the time that a cell spends in each phase of the cell cycle. When fast-dividing mammalian cells are grown in culture (outside the body under optimal growing conditions), the length of the cycle is about 24 hours. In rapidly dividing human cells with a 24-hour cell cycle, the G1 phase lasts approximately nine hours, the S phase lasts 10 hours, the G2 phase lasts about four and one-half hours, and the M phase lasts approximately one-half hour. In early embryos of fruit flies, the cell cycle is completed in about eight minutes. The timing of events in the cell cycle is controlled by mechanisms that are both internal and external to the cell.

Explanation:

Regulation of the Cell Cycle by External Events

Both the initiation and inhibition of cell division are triggered by events external to the cell when it is about to begin the replication process. An event may be as simple as the death of a nearby cell or as sweeping as the release of growth-promoting hormones, such as human growth hormone (HGH). A lack of HGH can inhibit cell division, resulting in dwarfism, whereas too much HGH can result in gigantism. Crowding of cells can also inhibit cell division. Another factor that can initiate cell division is the size of the cell; as a cell grows, it becomes inefficient due to its decreasing surface-to-volume ratio. The solution to this problem is to divide.

Whatever the source of the message, the cell receives the signal, and a series of events within the cell allows it to proceed into interphase. Moving forward from this initiation point, every parameter required during each cell cycle phase must be met or the cycle cannot progress.

Regulation at Internal Checkpoints

It is essential that the daughter cells produced be exact duplicates of the parent cell. Mistakes in the duplication or distribution of the chromosomes lead to mutations that may be passed forward to every new cell produced from an abnormal cell. To prevent a compromised cell from continuing to divide, there are internal control mechanisms that operate at three main cell cycle checkpoints. A checkpoint is one of several points in the eukaryotic cell cycle at which the progression of a cell to the next stage in the cycle can be halted until conditions are favorable. These checkpoints occur near the end of G1, at the G2/M transition, and during metaphase

plz mark me as brainleast my friend

Please help!
..........​

Answers

Answer:

我期望1个是正确的答案 并问老师好

Explanation:

你可以在书中找到

Which is an example of a ray-fin fish?
lungfish
O coelacanth
O shark
salmon

Answers

Explanation:

its showing all but salmon so im not sure,sorry, still trying

Answer: Salmon

Explanation:

bones

Give three reason why specialized systems are necessary in large multicellular organisms

Answers

Answer:

Specialized systems are necessary in large multicellular organisms since 1. there is a division of labor between cells, 2. many individual cells cannot work together without coordination, and 3. most of the cells are not in direct contact with the outside environment

hope it helps

pls mark me as brainliest

Specialized systems are necessary in large multicellular organisms since 1. there is a division of labor between cells, 2. many individual cells cannot work together without coordination, and 3. most of the cells are not in direct contact with the outside environment.

A rusty nail is an example of an oxidation-reduction reaction.
A. True
B. False

Answers

Answer:true

Explanation:

Type Newton's Second Law of Motion as it is written.

Answers

Answer:

I hope you understand please give brainliest

Explanation:

Newton's second law of motion can be formally stated as follows: The acceleration of an object as produced by a net force is directly proportional to the magnitude of the net force, in the same direction as the net force, and inversely proportional to the mass of the object.

Answer:

Yes it is written that second law of Newton is motion of an object

But this on your own sentences please

Answers

Since hydropower is powered by water, it’s a good fuel source. It will not contaminate the air like power plants that release fossil fuels, for example coal and oil. It does not rely on international fuel sources and lets each state make their own energy.

Put "Evolution of Populations" in a sentence

Answers

Answer:

animals are examples of evolution of population

Explanation:

What are 2 facts about energy?

Answers

Answer: Only 10 percent of energy in a light bulb is used to create light. ...

The amount of energy Americans use doubles every 20 years. ...

Explanation:

Fact 1: Refrigerators in the U.S. consume about the same energy as 25 large power plants produce each year.

Fact 2: From 2008 to 2030, world energy consumption is expected to increase more than 55%.

please help!! i’ll mark brainliest

Answers

Answer:

See if that helps, im pretty sure it increases :)

Explanation:

The rate of photosynthesis does not increase with higher temperatures for all plants. Plants which grow in colder climates have an optimum rate of photosynthesis at low temperatures. Therefore different types of plants have optimum temperatures for photosynthesis.

what are some products that come from plants?

Answers

Answer:

Aspirin tablets. Sponges. ...

Sponges made from trees. Chewing Gum. ...

Sapodilla tree. Carnauba Wax. ...

Copernicia prunifera. Henna Dye. ...

Henna tattoo. Rubber. ...

Tapping into trees for rubber.

Answer:

Rubber, sponges

Explanation:

these are Frome trees

When you by strawberry is "TEXTURE " matters? and why is that?

Answers

Answer:

Yes, it does.

Explanation:

If the strawberry you buy is all soggy and way too soft, it is likely rotten, while the normal texture we are used to shows that it is edible.

Answer:

Frozen strawberries were characterized organoleptically by a moist, soft and limp appearance, and poor shape retention. They felt very soft, moist, limp and slightly slimy in the mouth. Interior fibers had a tough texture.

Which of the following most accurately describes the National Postsecondary Agricultural Student Organization?
(a)A rival group to FFA.
(b)2.A group similar to FFA but for graduate students.
(c)A group similar to FFA but for college students.
(d)The British version of FFA.

Answers

Answer:

Explanation:

a

Answer:

It's a

Explanation:

How did scientists begin to Mark divisions in the geologic time scale in response to a change they discovered in the geologic record

Answers

Answer:

Scientists began to mark division on the geologic time scale when patterns and similarities started emerging from archeological studies. Patterns such as the discovery of fossils that were formed within the same period.

Explanation:

Geologists who study matter that make up the Earth's crust (whether solid gaseous or liquid), as well as matter from other terrestrial planets and the processes that influence the formation and condition of this matter, are called geologists.

They have successfully calibrated history into various phases of time intervals. These intervals are event-based intervals. For example, you have Eons, Eras, and Periods.

An Eon is a billion years. An example is the Neoproterozoid Eon. Eons are made up of several Eras and Eras are made up of periods. An example of an era is the Mesozoic era. Whilst periods are smaller units of an era, eg. Triassic era.

As scientists deduced the causes for the formation of fossils and topographical remains/patterns, they collected events that occurred within the same time period and group them together.

This range of events became known as the geological time scale.

The age of fossils and rocks is also used to map out the calibrations on the scale.

The age of fossils and rocks is determined using the process of radioactive dating.

Cheers

put "Speciation" in a sentence

Answers

Answer:

It flies in the face of currently accepted views of speciation.

Answer:

chromium speciation by different methods of practical use for routine in situ measurement.

Explanation:

Other Questions
A farmer needs to paint his granary and will need to know how much paint to order. In addition, he also needs to know how much grain the structure will hold. The granary is a cylinder in shape with a diameter of 10 meters, and a height of 28 meters. Answer the following:a. How many gallons of paint does he need to paint the exterior of the granary if one gallon of paint covers 35m2??hisb. Determine the maximum amount of grain the structure can store. each worker gets equal pay. fill in average product and marginal product (7 points). at what input level will marginal costs begin to rise? tonya is pregnant for a second time. she hopes to have a vaginal delivery, although her first delivery was cesarean. her doctor advises tonya that Which of the following is a positive strategy to support your immune system? O Put pressure on yourself, especially when you are sick. O Refrain from getting physical activity to stimulate your immune system. Avoid alcohol, tobacco, and medication or drug abuse. O Get less than eight hours of sleep. Diffusion of materials between the blood and body tissues occurs at which of the following blood vessels?A. capillariesB. venulesC. arteriesD. arteriolesE. veins In the early days of ribosome research, before the exact role of ribo- somes was clear, a researcher made the following observation. She could find, in sedimentation experiments on bacterial lysates, not only 30S, 50S, and 70S particles but also some particles that sedi- mented at about 100S and 130S. When she treated such a mixture with EDTA, everything dissociated to 30S and 50S particles. Upon adding divalent ions, she could regain 70S particles, but never 100S or 130S particles. (a) Suggest what the 100S and 130S particles might represent, in light of current knowledge of protein synthesis. What important dis- covery did the researcher miss? (b) Why do you think reassociation to 100S and 130S particles did not work? design and code i nbe t we e n as client code, using operations of the ar r a ysor t e dli s t class (the array-based sorted list class from chapter 6). lan is 1.83m tallDonna is 6cm shorterWhat is Donna's height in metres? Which person would be the best fit for a career in the Information Technology field? 1 What is the aim of this investigation? 2 3 Name the gas released by the submerged plant. Describe a test to verify your answer for question 2. 4 Describe the relationship between gas release and light intensity. 5 Name two other environmental factors, except light intensity, which you think could alter the rate of bubble production. TERM TWO Serine has pK 1 = 2.21 and PK 2 = 9.15. Use the Henderson-Hasselbalch equation to calculate the ratio neutral form/protonated form at pH = 3.05. Calculate the ratio, deprotonated form/neutral form, at pH = 9.87. Pay attention to significant figures in both the firm will earn zero economic profit if the market price is ___a. $0. b. $6. c. $7. d. $10. irrational beliefs and hypervigilance to any possible threats can sometimes contribute to feelings of anxiety. this best illustrates that anxiety disorders, ocd, and ptsd can be affected by the phenomenon of ______ occurs when two transactions, t1 and t2, are executed concurrently and the first transaction is rolled back after the second Jerry Osborn was told when she bought her corporate bonds that they would be recorded electronically. This means that Jerry purchased...A. Bond endenturesB. Registered bondsC. Trust agreementsD. Corporate savings bondsE. Convertible bonds the most common method of restoring competence in defendants is ______. What were mao's motives when he encouraged his troops to entertain and make friends with the local peasants along the route A firm in a perfectly competitive market can compete with other firms by advertising its product to attract more buyers. Is this statement true or false? Explain clearly. Hint: consider the assumptions of perfect competition as well as the impact of advertising costs on the firm's average cost of production and its profitability in the long-run. The sales tax rate for the state of Washington was 9.2%.a) What is the state sales tax on a $2,800 used car in Washington?b) What is the final cost of the car, including tax? question: what controls whether a solar eclipse will occur?