Answers
Answer:
Arteries carry blood away from the heart and veins carry blood back to the heart. The circulatory system carries oxygen, nutrients, and hormones to cells, and removes waste products, like carbon dioxide. These roadways travel in one direction only, to keep things going where they should.
Explanation: dont be men to me i have autism and savant syndrom
a = lil b = p c = a d = pi add it up lil papi
Explanation:
Related Questions
Given a DNA sequence of ACG, what would be the corresponding RNA sequence? Once you determine the RNA sequence, what would be the corresponding amino acid for the RNA codon? Would a change in one nucleotide of the DNA alter the corresponding amino acid? Explain.
Answers
Answer:
- RNA sequence: UGC
- Amino acid sequence: Cysteine
- Yes, a change in nucleotide will alter the amino acid.
Explanation:
According to this question, a DNA sequence was given as follows: ACG. The process of transcription will produce a RNA sequence from this DNA sequence using complementary base pairing i.e. A-U, G-C etc. Based on this, the mRNA sequence that will result of the DNA sequence above is UGC.
The resulting mRNA transcript is a codon (three nucleotides) that will be used in the process of translation to yield an amino acid. The mRNA sequence: UGC codes for amino acid Cysteine.
- A change in one nucleotide of the DNA will alter the corresponding amino acid because DNA sequence in a particular reading frame is responsible for the production of amino acid. Hence, a slight change in nucleotide might change the reading frame of the sequence and hence give rise to a different amino acid.
Which resource is nonrenewable? A. Wind B. Trees C. Coal D. Soybeans
Answers
What evidence do we have that all continents were merged into one super-continent called Pangaea 250 million years ago?
Answers
Glacial deposits, specifically till, of the same age and structure are found on many separate continents that would have been together in the continent of Pangaea. Fossil evidence for Pangaea includes the presence of similar and identical species on continents that are now great distances apart.
in what parts of the cycle do you think phosphorus spends the most time
Answers
Answer:
what is a phosphorus
Explanation:
Transcription is the process of making
Answers
This equipment can be used for plowing ,planting,cultivating,mowing soil and pulling farm machinery,what is it?
Answers
Determine the rate of oxygen consumption at each temperature for comparison. Then divide the higher rate by the lower rate to obtain the difference (ratio) between the two temperatures. Round your answer to the nearest 0.1. It can be concluded that mouse respiratory rate (increases or decreases) when temperature is lowered. In this experiment there was a fold difference in respiratory rate at the two temperatures.
Answers
Answer:
In mice rate of respiration increases as the temperature drops.
Explanation:
As the temperature decreases, the respiration rate also decrease because the body needs less oxygen for the production of energy. But in the case of mice, the rate of respiration decreases and the reason is the fear. Results showed that the respiration increased in mice as the decrease in temperature occur, caused due to the fear instilled in the mice towards cold temperature so in mice rate of respiration increases as the temperature drops.
Which feature of the Earth's surface is caused by wind?
A)
rock quarries
B)
canyons
C)
sand dunes
for
D)
mountains
Answers
Answer:
b canyons
Explanation:
Assume that one backbone of a DNA molecule has the sequence given below. A-T-G-G-G-G-G-C-G-A-T-A-T-T-T-T-A-T-C-C-G-A-C-G For this sequence: give the expected sequence of the other DNA backbone. T-A-C-C-C-C-C-G-C-T-A-T-A-A-A-A-T-A-G-G-C-T-G-C give the RNA sequence transcribed from the original DNA backbone. U-A-C-C-C-C-C-G-C-U-A-T-A-A-A-A-U-A-G-G-C-U-G-C give the Amino Acid sequence of the protein built from the original DNA backbone.
Answers
Answer:
DNA: ATGGGGGCGATATTTTATCCGACG
RNA: AUGGGGGCGAUAUUUUAUCCGACG
Protein: MGAIFYPT
Explanation:
Transcription is a genetic process by which the information in a strand of DNA is copied into RNA, typically a messenger RNA (mRNA) sequence which is subsequently used to create a protein by the process of translation. During translation, each triplet of nucleotides or 'codon' corresponds to a specific amino acid. For example, AUG is a codon that codes for methionine (M) and also acts as an initiation codon at the beginning of the nascent polypeptide chain.
Apply: Suppose a template strand of DNA had the following sequence: T A C G G A T A A C T A C C G G G T A T T C A A What would be the complementary strand of mRNA?
Answers
The corresponding nucleotide sequence is present on the coding strand. No complementary sequence exists on the template strand.
What changes occur in complementary strand from template?The DNA strand from which the mRNA is produced is known as the template strand. The DNA strand opposite the template strand is known as the coding, or non-template, strand, and it has the same sequence as mRNA except T to U substitutions.
The template strand, one of the two exposed DNA strands, acts as a model for transcription.
The RNA product is essentially identical to the non template (or coding) strand of DNA and is complementary to the template strand.
Therefore, AUG CCU AUU GAU GGC CCA UAA GUU is the complementary strand of mRNA.
Learn more about complementary strand here:
https://brainly.com/question/13768651
#SPJ3
they enjoy being alone and quiet for a small-time what are they?
Answers
Answer:
Introverts enjoy being alone because of acetylcholine) this chemical in the brain might induce a kind of happy feeling, for the introvert.
Sexual harassment in the workplace is a crime when committed by anyone, regardless of position, role, or gender. Please select the best answer from the choices provided ОТ OF
Answers
Answer:
The answer is true.
In a professional environment, sexually degrading comments and actions are legally prohibited.
Which is an adaptation that helps birds maintain a stable body temperature?
air sacs connected to lungs
large chest muscles
down feathers
nearly hollow bones
Answers
down feathers
Answer:
the answer is down feathers. Or C
Explanation:
I just took the unit review test
Based on scale of 100 and represents average performance
Answers
Answer:
Ok what is the question good sir/madam?
Answer:
Explanation:
Yes i agree with the other answer SIr or Ma'am but i don't know if this question!
Which of these genotypes represents a carrier?
Аа
aa
XXY
AA
Answers
Answer:
Aa
Explanation:
from what I can remember from 7th grade science
Which hot and dry biome is home to large herds of herbivores that feed on many types of grasses?
Answers
Answer:
grasslands
Explanation:
How is dopamine involved in drug addiction?
1) drugs change dopamine into another neurotransmitter.
2) drugs cause the reabsorption of dopamine.
3) drugs decrease dopamine levels in the brain.
4) drugs increase the level of dopamine in the brain
Answer and I will give you brainiliest
Answers
Answer:
The correct answer is - option D.
Explanation:
When an individual takes drugs such as heroin, nicotine, cocaine and methamphetamine increases or promotes the neurochemical reaction that increases the amount of dopamine which is a primary factor in addiction that is secreted by neurons in the brain's reward center.
Higher dopamine levels lead to pleasure in the mind of an addict and it makes people forget the pain or stress and gives immense pleasure.
Thus, the correct answer is - option D.
Because it's most resistant to deterioration, which type of molecule is most often found in molecular fossils?
A. RNA molecules
B. Protein molecules
C. DNA molecules
D. Lipid molecules
Answers
Answer:
Of the four main groups of organic molecules, Lipids are the most resistant to decay. They are also highly insoluble in water. All cells produce this type of organic compound to be used in their membranes and in energy storage. These type of organic molecules are found in kerogens
PLEASE HELP!!!!
Explain what causes a muscle to go into rigor mortis. Your answer should include the circumstances which cause it, as well as why those circumstances cause the effect (what is happening in the muscle at a molecular level which causes the stiffness).
Answers
Explanation:
Rigor mortis develops as the body's energy source (adenosine triphosphate [ATP]) is depleted. Muscle fibers require ATP for relaxation; once depleted, actin and myosin proteins remain complexed, resulting in stiffening of the muscles..
Thanks my answer and vote it 5 star and Mark it in brainliest answers please please please please please please please please please please please please please please please please please please please please please please
Ethylene, a hormone found in plants, is produced to ripen fruits. These fruits ripen and drop to the ground where they release seeds. Which two plant systems are interacting when this occurs?
Answers
Answer:
Response and reproduction system
Explanation:
Where do nutrients enter the body?
Answers
Answer:
thru the nucleus or cell wall i think
Explanation:
Answer: The small intestine absorbs most of the nutrients in your food.
Explanation: The small intestine is good for absorption due to it having a large inner surface area.
Which of these is an impact of burning coal for energy?
A. acid rain
B. mercury released into the waterways
C. Increased carbon dioxide in the environment
D. all of the above
Answers
B. Suspension c. Solution
D. Saturated solution
5. Which is a solvent in a cup of coffee?
A. coffee
B. creamer
c. sugar
D. water
6. Why should you shake the liquid medicine before drinking?
A. To make it effective. C. To mix the suspended particles at the bottom.
B. To make it taste better. D. To make it clear.
7. What should be done in a liquid medicine before drinking it?
A. Drink right away after opening. C. Let it stand for 3 minutes
B. Shake well
D. All of these
8. Which of the following is called a universal solvent?
A. water 8. gasoline C. juice D. diesel
m-Directions: For items 1-5 What method are you going
Answers
Answer:
5.c 6.c 7.b 8.a
Explanation:
I hope it helps u :)
PLEASE HELP ME!!!!!!!
Answers
Answer:
The last one
Explanation:
What is AB?
A
12
B.
C
35
Answers
Answer:
hah? i don't get it
Explanation:
Which statement is true about a red brick?
A red brick reflects red light and absorbs blue and green light.
O A red brick reflects blue light and absorbs red and green light.
A red brick reflects green light and absorbs blue and red light.
O A red brick reflects blue and green light and absorbs red light.
Answers
Answer:
1. red brick reflects red light and absorbs blue and green light.
The statement which is true about a red brick is: A. A red brick reflects red light and absorbs blue and green light.
An electromagnetic spectrum refers to a range of frequency and wavelength that an electromagnetic wave is distributed (extends).
Generally, an electromagnetic spectrum comprises the following radiations:
Gamma rays.Ultraviolet radiation. X-rays. Radio waves. Infrared radiation.Visible light.A visible light can be defined as the range of electromagnetic radiation or wavelength that the human eye can detect or see.
Also, the colors of the visible light spectrum are:
Red.Orange.Blue.Indigo.Green.For a red brick, all red light would be reflected while the other colors such as blue and green light are absorbed.
Read more: https://brainly.com/question/23419308
describe how you would test a sample of powdered milk to see if it contained protein
Answers
Answer:
How would you contained protein
Explanation:
One would test a sample of powdered milk to see if it contained protein by using copper sulfate solution and sodium hydroxide solution.
What is protein?A structure composed of amino acids. The body need proteins to function properly. They serve as the building blocks for several bodily components, including the skin, hair, and enzymes, cytokines, and antibodies.
An essential component of a balanced diet is protein. Amino acids are the chemical "building blocks" that make up proteins.
Amino acids are used by your body to create hormones, enzymes, and to build and repair muscles and bones. They can be utilized as a source of energy as well.
The test can be done as:
To your meal solution, add a few drops of copper sulfate solution. A few drops of sodium hydroxide solution should be added. Protein is present in the food if the solution becomes purple.Thus, using copper sulfate solution and sodium hydroxide test, one can determine the protein content in the sample.
For more details regarding protein, visit:
https://brainly.com/question/29776206
#SPJ2
You are studying brain cells and you discover a protein neurotransmitter that you
think might be useful. You know the amino acid sequence of the neurotransmitter.
Explain:
a) how you would isolate and identify the neurotransmitter gene
b) how you would produce multiple copies of the gene for study
c) how you would produce large quantities of the neurotransmitter to see if it could be
used as a potential medication.
e
Answers
In ancient times, people believed Earth was the center of the Solar System. Which of the following makes the geocentric model impossible?
O The moon revolves around Earth.
O Earth's gravitational force is much less than the Sun's.
o Orbits are elliptical, not circular
There are other planets that are closer to the Sun.
Answers
I hope I was helpful! Have a nice day! ~(^v^)~
HELP ME
MARKING BRANELIST
Answers
Answer:
I think the answers probably b