T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Answers

Answer 1

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Answer 2

Answer:

C

Explanation:


Related Questions

describe how energy is transferred through a food chain


PLSS ANSWER IM BEGGING YOU

Answers

Well energy is transferred between organisms in food webs from producers to consumers. The energy is used by organisms to carry out complex tasks. The vast majority of energy that exists in food webs originates from the sun and is converted (transformed) into chemical energy by the process of photosynthesis in plants.on:

Answer:

Energy is passed between organisms through the food chain. Food chains start with producers. They are eaten by primary consumers which are in turn eaten by secondary consumers. They are then eaten by tertiary consumers and in a long food day these can be eaten by quaternary consumers.

Which of the following best describes the relationship between the level of genetic
variation and adaptability?

Answers

Answer:

All adaptations are variations and all variations help organisms survive

Explanation:

hope this helps

How do the structures of organims body be used as evidence of evolution?​

Answers

Homologous structures suggest that comparable selected pressures can produce similar adaptations, whereas analogous structures show that similar selective pressures can cause similar adaptations (beneficial features).
Similarities and differences among biological molecules (for example, in the DNA sequence of genes) can be utilized to assess the relatedness of species.

I hope this helps you
:)

Which of the following is a way homeowners can protect their homes from f building near floodplains relocating furnaces and water heaters O helping build dams developing building codes​

Answers

Helping build dams developing building codes is a way to help homeowners to protect their building from flood plain.

What are flood plains?

Floodplain refer to an area of land that is adjacent or opposite to a river which stretches from the banks of its channel to the bottom of an enclosed valley walls, and which experiences flooding during periods of high discharge.

Therefore, helping build dams developing building codes is a way to help homeowners to protect their building from flood plain because it will act as a collector of water and barrier that will prevent flood.

Learn more about flood plain here.

https://brainly.com/question/1000851

Answer:

1. relocating existing homes off of the floodplain

relocating existing homes off of the floodplain

restricting new homes from being built on the floodplain

2. relocating furnaces and water heaters

3. stormwater management

Explanation: I took the test and got 100%. =)

Why might using other sources of power, like wind and solar energy, help to slow global warming? A. All types of energy cause global warming to increase. B. Wind and solar energy require heat from the sun, which would lower global temperatures. C. Wind and solar energy do not require the use of fossil fuels. D. Wind and solar energy use carbon dioxide, which would help remove it from the atmosphere.

Answers

Answer:

c

Explanation:

fossil fuels release greenhouse gasses into the atmosphere, not using them would end a lot of that pollution, thus lowering global warming

the Brain consists of __ neurons
A. 1 Billion
B. 100 Billion
C. 100 Million
D. 10 Million​

Answers

Answer:

1 billion

i guess is answer

Answer:

b. 100 billion

Explanation:

Pls help me
Insectivorous birds are birds that have a diet where their primary food source is insects. In the fall and winter months in the Northeast region, the temperature starts to drop and insects become scarce. What happens to the carrying capacity for insectivorous birds in winter in a northern New York forest?

It stays constant, since carrying capacity is a fixed value that does not change.
It quickly drops to zero once the temperature goes below freezing.
It slightly fluctuates above and below the optimum level.
It rapidly increases during the winter.

Answers

The carrying capacity of the insectivorous birds in winter of the northern New York forest quickly drops to zero once the temperature goes below freezing.

What is carrying capacity?

Carrying capacity refers to as the average population size of a species in a particular habitat.

The population size of a species can be affected by environmental factors such as adequate food, shelter, water, and mates etc.

According to this question, the primary source of food for insectivorous birds decline during winter periods. This means that the carrying capacity of the birds will as decrease.

Learn more about carrying capacity at: https://brainly.com/question/2375972

Answer:

It quickly drops to zero once the temperature goes below freezing.

Explanation:

I took on FLVS

NO LINKSS I REALLY NEED HELP PLSSSSSSS analyze the experimental resulty of this doc​

Answers

I’m sorry, what’s the question?

Which of the following muscles are used when breathing?
O A) Interosseous and the diaphragm
B) Intercostal and the diaphragm
C) Intercostal and pectoral
D) Interosseous and pectoral

Answers

B) Intercostal and the diaphragm

The diaphragm and intercostal muscles are two of the most important breathing muscles.

I hope this helps you
:)
B) Intercostal and the diaphragm

what is The basic unit of biological classification

Answers

Explanation:

The basic unit of biological classification is Species

Using the Internet, local newspapers, and/or any regional information, write a 600 word report on one of the following companies:

Coca-Cola ®
McDonald's ®
ServiceMaster ®
Southwest ® Airlines
Give some of the reasons for their success in the business world. Do they emphasize friendliness? How does management treat workers? How does the company handle complaints?

You may want to give a local representative a phone call or e-mail and ask for some further information.

Answers

My report is on the Coca Cola company.

How did Coca-Cola begin?

Coca-Cola began in 1886 when the Atlanta pharmacist, Dr. John S. Pemberton create a distinctive tasting soft drink that could be sold at soda fountains.

How coca cola became famous?

By the late 1890s, Coca-Cola was one of America's most popular fountain drinks due to Candler's aggressive marketing of the product. The Coca-Cola Company increased sales by over 4,000 percent between 1890 and 1900.

How coca cola became successful?

One of the reasons that Coca Cola brand is so successful is that it has focused on building its brand, instead of its product. It creating an idea of what life with Coke is like rather than its taste.

The reasons for their success in the business world are unique taste, better quality and advertisement. The company handle complaints by lanuching customer service center where the complainants register their complaints and the company will act accordingly.

Learn more about company here: https://brainly.com/question/24553900

Environmental resistance includes
biotic/abiotic factors that are
to life.

Answers

Answer:

The environmental resistance factors are all the factors or things that keep a population of the organisms from endlessly increasing i.e. keep a check on it. . They reduce the chances for reproduction, affect the health of organisms/individuals, and raise the death rate in the population.

The environmental resistance factors include the factors that are biotic and abiotic.

• The biotic factors are things like a predation, a parasitism, lack of food, competition with other organisms and disease.

• Abiotic factors include factors like drought, fire, temperature, and even the wrong amount of sunlight could affect it.

1. What is the significance of the specific gravity of the abnormal urine?

Answers

Answer:

A very high specific gravity means very concentrated urine, which may be caused by not drinking enough fluid, loss of too much fluid (excessive vomiting, sweating, or diarrhea), or substances (such as sugar or protein) in the urine.

Explanation:

Urine specific gravity is a significant and convenient way to measure the abnormal urine. It indicates dehydration or presence of substances in the urine as in case of diabetes.

What is Specific gravity?

Urine specific gravity (USG) measures the concentration of particles which are present in the urine and the density of urine compared with the density of water. Measurement of USG is an easy way and very convenient way to know a patient's hydration status as well as the functional ability of kidneys.

Urine specific gravity falls between the range of 1.002 and 1.030 if the kidneys are functioning normally. However, if specific gravity results above 1.010 this can indicate mild dehydration in that person. The higher the number of specific gravity, the more dehydrated a person may be.

A very high specific gravity means very concentrated urine, which may be due to not drinking enough fluid, loss of too much fluid, or substances such as sugar or protein in the urine.

Learn more about Specific gravity here:

https://brainly.com/question/8808140

#SPJ2

Which of these planets has characteristics most similar to Saturn?
Jupiter, Uranus, and Neptune
Mercury, Venus, and Earth
O Venus, Earth, and Mars
Earth, Mars, and Saturn

Answers

Jupiter, People think that the insides of them are similar to Saturn.
Jupiter, Uranus and Neptune. With Jupiter, it contains a small rocky core surrounded by hydrogen and helium, with trace amounts of various volatiles. Saturn and Neptune are gas giants, both largely comprised of hydrogen and helium. Finally, Like Saturn, Uranus has rings and moons.

Hope this helped!

Which biologically-based therapy uses a drug to remove toxic amounts of
metal from the blood?
A. Herbal medicine
B. Diet therapy
C. Chelation therapy
D. Orthomolecular therapy

Answers

Answer:

Your answer is C) Chelation therapy

Explanation:

Chelation therapy is a method for removing heavy metals, such as mercury or lead, from blood. It's one of the standard treatments for many types of metal poisoning. Hope this helped :)

Chelation therapy is used to remove toxic amounts of metal from the blood. So, the correct option is C.

What do you mean by Drug therapy?

Drug therapy may be defined as the process of treating, diagnosing, and preventing any specific disease with the help of chemical substances known as drugs.

Chelation therapy is given intravenously to the patients for the treatment of heavy metals exposure like mercury, lead, and chromium in the blood. After successful completion of chelation therapy, toxic heavy metals are removed via urination.

Therefore, chelation therapy is used to remove toxic amounts of metal from the blood. So, the correct option is C.

To learn more about Chelation therapy, refer to the link:

https://brainly.com/question/8781452

#SPJ2

Do these fossils support the theory of evolution?

Answers

Answer:

yes because the animal changed over time

Explanation:

What evidence did Galileo provide to support Copernicus's heliocentric model? Check all that apply.
Galileo determined the shape of each planet's orbit by a mathematical method called triangulation from different
points on Earth's orbit.
Galileo created a model showing the epicycles of the planets, which explained retrograde motion.
Galileo used a telescope to study the moons orbiting Jupiter. This showed that Earth was not the center of all
things.
U Galileo explained that people did not see stellar parallax because the stars were simply other suns that are very
far away.
Galileo discovered the phases of Venus, proving that at least one planet orbited the Sun.
Intro
Done

Answers

Answer:

- Galileo used a telescope to study the moons orbiting Jupiter. This showed that Earth was not the center of all things.

-Galileo discovered the phases of Venus, proving that at least one planet orbited the Sun.

Explanation:

Galileo discovered evidence to support Copernicus’ heliocentric theory when he observed four moons in orbit around Jupiter. Beginning on January 7, 1610, he mapped nightly the position of the 4 “Medicean stars” (later renamed the Galilean moons). Over time Galileo deduced that the “stars” were in fact moons in orbit around Jupiter.

At about the same time, German mathematician Johannes Kepler was publishing a series of laws that describe the orbits of the planets around the Sun. Still in use today, the mathematical equations provided accurate predictions of the planets’ movement under Copernican theory. In 1687, Isaac Newton put the final nail in the coffin for the Aristotelian, geocentric view of the Universe. Building on Kepler’s laws, Newton explained why the planets moved as they did around the Sun and he gave the force that kept them in check a name: gravity.

Hope this helps!
If you have any queries please ask.

PLEASE HELP TWO QUESTION !!!!!!!!!!!! (2O POINTS!)

q1
Mosquitoes have many interesting sensory abilities. They have chemical sensors that can sense body sweat, humidity, and CO2 and they have heat sensors to find warm-blooded animals. What is the purpose of these sensors?

A For movement
B For obtaining food
C For protection
D For mating

q2
An artic fox develops a white coat of fur during the winter. This adaptation allows an organism to defend itself by blending into its environment called__?

A shedding
B migration
C hibernation
D camouflage

Answers

A, d, it is A and D

Which specific anterior pituitary hormone stimulates
cortisol steroid hormone production?

Answers

Answer :Adrenocorticotropic hormone

Explanation:

Adrenocorticotropic hormone (ACTH) is produced by the pituitary gland. Its key function is to stimulate the production and release of cortisol from the cortex (outer part) of the adrenal gland.

Is any component more important than the others? Explain why or why not.

Answers

Answer:

hmm

E

Yeah. That's a tricky one.

First discovered enzyme is?

Answers

Answer:

The first discovered enzyme was Zymase. It naturally occurs in the yeast and helps in fermenting the sugar molecules producing carbon dioxide and ethanol.

explain why norepinephrine requires a protein receptor to exert its effects.

Answers

Answer:

I'm going off the top of my head for this one, and this is an educated guess, so check it if you would like to. When the norepinephrine binds to a protein, then the protein relays the info to the cells that are required to do the specific action. This is why we feel a sense of stress, elevated heart rates, or high alertness.

(I'm 13 so you might want to check a lot)

what causes slab pull in earths crust

Answers

Answer:

The process of a tectonic plate descending into the mantle is termed subduction. Slab pull occurs when an oceanic plate subducts into the underlying mantle. Subduction zones are just one type of convergent boundary where two tectonic plates are colliding.

Explanation:

High-efficiency particulate air (HEPA) filters are designed to remove which sized particles from the environment? 0.1 microns or smaller a) b) 0.3 microns or larger O c) 0.1 microns or larger d) 0.3 microns or smaller

Answers

Answer:

d) 0.3 microns or smaller

differences between the three classes of platyhelminthes​

Answers

Answer:

The phylum Platyhelminthes consist of three different classes: Turbellaria, Cestoda and Trematoda. Class turbellaria is composed of many free-living organisms, while some are parasitic. Trematodes are commonly known as flukes. They are parasitic flatworms with an unsegmented body.

Explanation:

The three classes of Platyhelminthes are Turbellaria, Cestoda, and Trematoda.

What are the differences between the three classes of Platyhelminthes?

Flatworms are members of the Platyhelminthes phylum. The Turbellaria, popularly known as planarians, the Trematode, usually known as flukes, and the Cestoda, also known as tapeworms, are the three classes that make up the phylum Platyhelminthes. Flatworm species come in more than 25,000 different varieties.

The four classes of Platyhelminthes are Cestoda (tapeworms), which are internal parasites of many vertebrates; Trematoda (internal parasites of humans and other species); and Turbellaria (free-living marine species).

Thus, these are the differences between the three classes of platyhelminthes.

Learn more about platyhelminths, here:

https://brainly.com/question/14793366

#SPJ2

Identify if it is biotic or abiotic. And if it is a biotic identify if they are producers, herbivores, carnivores, omnivores, scavengers or decomposers.
1. Nutrients
2. Air
3. Volcanic eruption
4. Lion
5. Koala
6. Typhoon
7. Fire
8. Rocks
9. Vulture
10. Mushroom

please help me if u can answer this brainliest ​

Answers

Answers:

1. Nutrients: Abiotic

2. Air: Abiotic

3. Volcanic eruption: abiotic

4. Lion: biotic, Carnivores

5. Koala: biotic, herbivores

6. Typhoon: abiotic

7. Fire: abiotic

8. Rocks: abiotic

9. Vulture: biotic, scavengers (it eats dead organisms to grow)

10. Mushroom: biotic, scavengers (it eats dead organisms to grow)

hope it is helpful,

STAY SAFE

Can someone PLease help me with these questions?!

Answers

Answer:

I can't read it. It is too small

Explanation:

It is too small for me to read

Find a picture or video regarding optical illusions and post a link. Describe what is happening in the eye or brain that creates that illusion!

Helpppp pleaseeee

Answers

Search up Herman Grid Illusion for the picture and submit that.

Explanation.
Where the white lines intersect in the middle are surrounded by more white on all sides than any other point along the white line segments. Your retinal ganglion cells notice that there is more white around where they meet because they are organized to increase contrast with lateral inhibition. Better contrast makes it easier on our eyes to see the edge of something. Your retinal ganglion cells don’t respond as much at the intersections because there is more lateral inhibition for more white spots nearby, compared to the lines which are surrounded with black.

Simpler explanation:
White lines cross across a black background. Where the lines cross, there is a higher contrast. Your retinal ganglion cells notice that there is more white around where they meet, making them not respond as much at the intersections. There is more lateral inhibition, where neurons response to stimulus is restrained by the activity of nearby excited neurons, for more white spots nearby.

Hope this helps!

True or false? Because they share similar structures, cells all carry out the same function.


Answer: False

Answers

Answer: The structural and functional characteristics of different types of cells are determined by the nature of the proteins present. Cells of various types have different functions because cell structure and function are closely related.

Explanation:

Describe how an ecosystem that contains insects, water, algae, and bird work together to provide life.

Answers

Answer:

An ecosystem that contains insects, water, algae, and birds all work together by feeding one-another.

Explanation:

Algae are typically found within water. Algae use carbon dioxide, converting water to organic matter and oxygen. They are important sources of dissolved oxygen in a water confine.

Now, since algae help water by oxygenating it, living things are able to drink the water.

..This helps the bird, since it needs to drink water. As all living things do.

Sorry if this is a little confusing!

Other Questions
Who was buried under Monks Mound Adrian is frying an egg for breakfast. All of a sudden, his phone rings. When he turns back around to check on the egg, he accidently touches thehot stove. How will his nervous system work to help protect his body? Helppp.First, complete the sentence to show how the figure can be decomposed into triangles and rectangles with the fewest number of pieces.Then find the area of the divisions. Give me words to describe Jason Momoa's physique. Please, Im writing a fiction story on him and need to explain how he looks through the eyes of a woman, Ive run out of ideas. Select the three equations that are equivalent to the equation 3x4=5.1. 3x = 92. 3x - 4 + 4 = 5 + 43. x = 9 4. x - 4 = 25. -4 = 5 - 3x 7. Which substance, if added to a saturated solution ofNH4OH, would cause the pH of the solution to increase?A. HCIB. NH4C1C. LiOHD. CH3OH A B C D isosceles triangle Which term best describes vthe figure shown below Can anyone solve this correctly? What is the area of this quadrilateral What music does a trombone play Simplify 2b 7+3+4 +3 What is tris lysis buffer An Olympic diver is competing for a medal. His height in feet above the watercan be modeled by the function f(x)= -2(x-5)(x+1), where x is the time in secondsafter he begins the dive. Find how long it takes the diver to reach the water? A manager drew this box-and-whisker plot to represent the ages of the company's 240 employees.Box-and-whisker plot ranging from 34 to 58 with ticks at increments of 1. Plot defined by points at 35, 42, 49, 54, 57.How many employees are younger than 42?Select from the drop-down menu to correctly complete the statement.About Choose... 24,48,60,75 employees are younger than 42. What are the major factors that determine investment, and what impact does each have on aggregate demand? The day i was late at important function What animal lives in the yangtze river and is represented by its own rare xingyiquan form?. Humans can distinguish up to 18,400,000 individual dots called pixels on a typical computer display. Can a human distinguish pixels on a same-sized HDTV with 210^6 pixels? Explain 529 as a desmil number