The following is a trapezoid. Find Angle XWZ, Angle XMY, and Angle YMZ

The Following Is A Trapezoid. Find Angle XWZ, Angle XMY, And Angle YMZ

Answers

Answer 1

According to the figure of the trapezoid

angle XMZ = 115 degrees

angle XMY = 102 degrees

Angle YMZ = 78 degrees

How to find the missing angles

The given figure is an isosceles trapezoid, hence

angle XMZ + angle XYZ = 180

angle XYZ = 39 + 26 = 65

angle XMZ + angle XYZ = 180

angle XMZ = 180 - 65

angle XMZ = 115 degrees

angle XMY

angle XMY =  180 - 39 - 39 = 180 - 78 = 102 degrees

Angle YMZ + angle XMY = 180 (angle on a straight line)

Angle YMZ = 180 - angle XMY = 180 - 102 = 78 degrees

Learn more about isosceles trapezoid at

https://brainly.com/question/10644521

#SPJ1


Related Questions

Kristin left the movie theater and traveled
toward the lake at an average speed of 33
km/h. Jennifer left sometime later
traveling in the opposite direction with an
average speed of 45 km/h. After Kristin
had traveled for two hours they were 156
km apart. How long did Jennifer travel?

Answers

AnswerTherefore, Jennifer traveled for 2 hours.

Step-by-step explanation:

Let x be the time Jennifer traveled.

Kristin traveled for 2 hours at 33 km/h, so she had traveled 66 km when Jennifer started traveling.

After x hours, Jennifer had traveled 45x km.

The total distance between them was 156 km.

So, we have:

66 km + 45x km = 156 km

Simplifying the equation, we get:

45x km = 90 km

x = 2 hours

Therefore, Jennifer traveled for 2 hours.

Which table was created using the equation y = 4x-1?
A
C
Input (x) Output (y)
3
11
4
15
27
31
35
39
5
6
7
8
Input (x) Output (y)
3
42
43
45
47
48
49
4
5
7
8
B
D
Input (x) Output (y)
3
11
15
19
23
27
31
4
5
6
7
8
Input (x) Output (y)
3
42
4
43
44
45
46
47
5
6
7
8

Answers

Answer:

Table B was created using the equation y = 4x-1.

Explanation:

The equation y = 4x-1 means that for any given value of x, the corresponding value of y can be found by multiplying x by 4 and then subtracting 1.

Table B shows input values of x and output values of y that are consistent with this equation. For example, when x = 3, y = 11 (4 * 3 - 1), and when x = 4, y = 15 (4 * 4 - 1), and so on.

Therefore, we can conclude that Table B was created using the equation y = 4x-1.

What is the value of n?

Enter your answer in the box.

n = __ cm

Answers

The value of the missing segment n using the product of intersecting chord theorem is 14cm

Using the product of intersecting chord principle

The product of the segments of two intersecting chords are equal.

The segments of the chords ;

Chord 1 = 4 and n

Chord 2 = 7 and 8

The principle can be related Mathematically thus ;

4 × n = 7 × 8

4n = 56

Divide both sides by 4

4n/4 = 56/4

n = 14

Therefore, the value of n in the question is 14cm

Learn more on circles ;https://brainly.com/question/14868497

#SPJ1

how do you solve this

Answers

Answer:

Θ ≈ 103°

Step-by-step explanation:

using the Cosine rule in Δ ABC

cosB = [tex]\frac{a^2+c^2-b^2}{2ac}[/tex]

where a is the side opposite ∠ A , b the side opposite ∠ B and c the side opposite ∠ C

here a = 42 , b = 78 and c = 57 , then

cos B = [tex]\frac{42^2+57^2-78^2}{2(42)(57)}[/tex]

          = [tex]\frac{1764+3249-6084}{4788}[/tex]

          = [tex]\frac{5013-6084}{4788}[/tex]

         = [tex]\frac{-1071}{4788}[/tex] , then

B = Θ = [tex]cos^{-1}[/tex] ( - [tex]\frac{1071}{4788}[/tex] ) ≈ 103° ( to the nearest degree )

What is the answer pls

Answers

so first you find the area of the circle
this is pi x r^2
therefore it is pi x 3^2
9pi
now do 9pi x 17
480.66367…
480.66cm^3

Prior to June 30, a company has never had any treasury stock transactions. The company repurchased 185 shares of its $1 par common stock on June 30 for $42 per share. On July 20, it reissued 90 of these shares at $46 per share. On August 1, it reissued 70 of the shares at $40 per share. What is the journal entry necessary to record the reissuance of treasury stock on July 20?

Answers

On July 20, the journal entry to record the reissuance of treasury stock is: Debit Cash for $4,140 and credit Treasury Stock for $4,140.

To record the reissuance of treasury stock on July 20, the company needs to make the following journal entry:

Date: July 20

Account Debit Credit

Cash $4,140

Treasury Stock $4,140

Explanation:

Debit to Cash ($46 per share * 90 shares) to record the cash received from the reissuance of 90 shares of treasury stock: $46 * 90 = $4,140.

Credit to Treasury Stock to remove the cost of the 90 reissued shares from the treasury stock account.

This journal entry reflects the cash inflow from the reissuance of treasury stock and reduces the balance in the treasury stock account, indicating a reduction in the number of shares held by the company as treasury stock.

For more such questions on journal entry

https://brainly.com/question/28390337

#SPJ8

Use the given information about
to find the exact value of cos 0/2

Answers

The exact value of cos(θ/2) is:

[tex]cos(\frac{\theta }{2}) = \right-\sqrt{\frac{1}{122} }[/tex]

How to find the exact value of cos (θ/2)?

To find the exact value of cos(θ/2), we can use the half-angle formula for cosine:

[tex]cos(\frac{\theta }{2}) = \right\pm\sqrt{\frac{1+cos\theta}{2} }[/tex]

First, let's find the value of cos(θ) using the given information about θ:

Given:

tan(θ) = 11/60

θ lies in the 3rd quadrant (π < θ < 3π/2)

In the 3rd quadrant, both sin(θ) and cos(θ) are negative.

tan(θ) = opposite/adjacent

Also, in the 3rd quadrant, both opposite and adjacent are negative.

Thus,

opposite = -11

adjacent = -60

hypotenuse = √[(-60)² + (-11)²]   (Pythagoras theorem)

hypotenuse = 61

cos(θ) = adjacent/hypotenuse

cos(θ) = -60/61

Finally, we can substitute these values into the half-angle formula for cosine:

[tex]cos(\frac{\theta }{2}) = \right\pm\sqrt{\frac{1+(\frac{-60}{61})}{2} }[/tex]

[tex]cos(\frac{\theta }{2}) = \right\pm\sqrt{\frac{\frac{1}{61} }{2} }[/tex]

[tex]cos(\frac{\theta }{2}) = \right\pm\sqrt{\frac{1}{122} }[/tex]

Since the cos(θ/2) is negative. Therefore, the exact value of cos(θ/2) is:

[tex]cos(\frac{\theta }{2}) = \right-\sqrt{\frac{1}{122} }[/tex]

Learn more about trigonometric identity on:

brainly.com/question/24496175

#SPJ1

William Oughtred is most famous not for his mathematical discoveries, but rather for introducing two mathematical symbols. What are they?​

Answers

The two mathematical symbols that William Oughtred introduced are "×" for multiplication and "::" for proportion.

Given is a statement about William Oughtred.

William Oughtred is most famous not for his mathematical discoveries, but rather for introducing two mathematical symbols.

We have to find those symbols.

William Oughtred is actually an English priest who basically teaches the students in mathematics subject.

He did invent other famous things like slide rule.

But the most famous invention of him is two mathematical symbols which are "×" for multiplication and "::" for proportion which are still widely used symbols.

Learn more about Slide Rule here:

https://brainly.com/question/32100142

#SPJ1

pls help me with this

Answers

Option C is the table of values representing a proportional relationship in the context of this problem.

What is a proportional relationship?

A proportional relationship is a relationship in which a constant ratio between the output variable and the input variable is present.

The equation that defines the proportional relationship is a linear function with slope k and intercept zero given as follows:

y = kx.

The slope k is the constant of proportionality, representing the increase or decrease in the output variable y when the constant variable x is increased by one.

For item c, we have that the output is equals to the input, hence the proportional relationship is given as follows:

y = x.

Missing Information

The problem asks for which table represents a proportional relationship.

A similar problem, also featuring proportional relationships, is presented at https://brainly.com/question/7723640

#SPJ1

enter the number that belongs in the green box

Answers

The measure of unknown angle of triangle is 28.2°.

From the given triangle, we have sides 11 units, 12 units and 20 units.

The law of cosine states that the square of any one side of a triangle is equal to the difference between the sum of squares of the other two sides and double the product of other sides and cosine angle included between them. The law of cosine states that: a² = b² + c² − 2bc·cosA.

Here, 11²=12²+20²-2×12×20·cosA

121=144+400-480·cosA

121=544-480·cosA

121-544=-480·cosA

-423=-480·cosA

cosA= 423/480

cosA= 0.88125

A=28.2°

Therefore, the measure of unknown angle of triangle is 28.2°.

Learn more about the cosine rule here:

https://brainly.com/question/28716982.

#SPJ1

Don Arnoldo heredó una parcela de forma rectangular, en la cual el largo más el ancho mide 30 metros y la diferencia entre el largo y el ancho es de 6 metros. ¿Cuánto mide de largo y de ancho la parcela?

Answers

Por lo tanto, la parcela mide 18 metros de largo y 12 metros de ancho.

Llamemos "largo" (L) a una de las dimensiones de la parcela y "ancho" (A) a la otra dimensión.

Según la información dada, sabemos que la suma del largo y el ancho es de 30 metros:

L + A = 30 ---(1)

También se nos dice que la diferencia entre el largo y el ancho es de 6 metros:

L - A = 6 ---(2)

Podemos resolver este sistema de ecuaciones utilizando el método de sustitución o de eliminación. En este caso, resolveremos utilizando el método de sustitución.

De la ecuación (2), podemos despejar L en términos de A:

L = A + 6

Sustituyendo este valor de L en la ecuación (1), obtenemos:

(A + 6) + A = 30

2A + 6 = 30

Restamos 6 de ambos lados de la ecuación:

2A = 30 - 6

2A = 24

Dividimos ambos lados de la ecuación por 2:

A = 12

Ahora que conocemos el valor de A, podemos encontrar el valor de L sustituyendo en la ecuación (2):

L = A + 6

L = 12 + 6

L = 18

For similar questions on parcela

https://brainly.com/question/23275489
#SPJ11

Match the prompts together.

Answers

When matched, the prompts on asymptotes would be:

Vertical asymptote at x=0: The cost of producing pills can never reach 0.Decreasing on (0,∞): As the number of pills produced gets smaller, the average cost of production greatly increases.Horizontal asymptote at y=0: The cost of producing pills cannot be negative.Positive on (0,∞): As more pills are produced, the average cost per pill decreases.

How to match the asymptote statements ?

The presence of a vertical asymptote at x=0 signifies that the cost of producing pills can never reach a value of 0, remaining persistently positive. Simultaneously, the horizontal asymptote at y=0 serves as a reassuring indication that the cost of producing pills cannot be negative, as it steadfastly remains at or above zero.

This crucial constraint ensures that the cost incurred in the pill production process is always a non-negative quantity. Consequently, the prompt related to the impossibility of negative costs aligns with this notion.

Find out more on horizontal asymptote at https://brainly.com/question/1851758

#SPJ9

Name at least ONE method a person can use to send money to another person who does not have a bank account.​

Answers

Answer:

One method that a person can use to send money to another person who does not have a bank account is through a money transfer service like Western Union or MoneyGram. These services allow individuals to send money to recipients who can then collect it in cash from designated locations. The sender can visit a local agent or use an online platform to initiate the transfer, providing the recipient's name and other required details. The recipient can then go to a nearby agent location with proper identification to receive the cash. This method provides a convenient way to send money to individuals who may not have access to traditional banking services.

Step-by-step explanation:

Person 1 takes money out of wallet, gives money to person 2.

BOOM!

Jaxon is flying a kite, holding his hands a distance of 3.25 feet above the ground and letting all the kite’s string play out. He measures the angle of elevation from his hand to the kite to be 24


. If the string from the kite to his hand is 105 feet long, how many feet is the kite above the ground? Round your answer to the nearest tenth of a foot if necessary.



Answers

We can use trigonometry to solve this problem. Let's draw a diagram:

```
|\
| \
| \ kite (to be found)
| \
|24°\
| \
| \
| \
| \
| \
| \
|_________\
J 3.25 ft
```

In this diagram, J is Jaxon's position, and we want to find the height of the kite above the ground. We know the distance from Jaxon's hands to the ground (3.25 feet), the length of the string (105 feet), and the angle of elevation from Jaxon's hands to the kite (24 degrees).

Let's call the height of the kite above the ground h. Then we can use the tangent function, which relates the opposite side (h) to the adjacent side (105 feet) and the angle of elevation (24 degrees):

tan(24 degrees) = h / 105

Solving for h, we get:

h = 105 tan(24 degrees) ≈ 44.8 feet

Therefore, the kite is approximately 44.8 feet above the ground. Rounded to the nearest tenth of a foot, the answer is 44.8 feet.

Pls help . Thx
…………….

Answers

Altogether they have 85 marbles.

Given,

Randy's marbles = 50

Randy's marbles is 5/2 of Andy's marbles.

Randy's marbles is 10/3 of Peter's marbles.

Now form the linear equations,

Let Andy has x marbles.

So,

5/2 × x = 50

x = 20

Andy's marbles = 50

Let Peter has y marbles.

So,

10/3 × y = 50

y = 15

Peter's marbles = 15

Thus total marbles of Randy , Andy , Peter is 85.

Know more about equations,

https://brainly.com/question/20778317

#SPJ1

Answer:

85 marbles

Step-by-step explanation:

Andy has 20

Randy has 50

Peter has 15

Question 5 of 10
What can you say about the y-values of the two functions f(x) = 32 - 3
and g(x) = 7x² - 3?
A. The minimum y-value of f(x) is -3.
B. The minimum y-value of g(x) is -3.
C. g(x) has the smallest possible y-value.
D. f(x) has the smallest possible y value.
SUBMIT

Answers

The minimum y-value of g(x) is -3 and g(x) has the smallest possible y-value.

The function  f(x) = 32 - 3 is a constant function, as there is no variable term involving x. It simplifies to f(x) = 29.

Regardless of the value of x, the function f(x) will always have a y-value of 29.

Therefore, option A is incorrect because there is no minimum y-value for f(x); it is a constant.

g(x) = 7x² - 3 is a quadratic function in the form of ax² + bx + c, where a = 7, b = 0, and c = -3.

The coefficient a (7) is positive, indicating that the parabola opens upward.

Since there is no linear term (bx), the vertex of the parabola is located at the point (0, -3), which corresponds to the minimum y-value of the function.

To learn more on Functions click:

https://brainly.com/question/30721594

#SPJ1

In circle F with mZEFG = 70 and EF = 19 units, find the length
of arc EG. Round to the nearest hundredth.
E
F
G

Answers

Answer:

Arc EG = 23.21 units

Step-by-step explanation:

Arc length:

Arc length could be found by the below mentioned formula.

         [tex]\boxed{\bf Arc \ length =\dfrac{\theta }{180}*\pi r}[/tex]

r - radius of circle = 19 units

Ф - central angle of arc = 70°

                             [tex]\sf arc \ EG = \dfrac{70}{180}*3.14*19\\\\[/tex]

                                         = 23.21 units

.Se lanzan tres monedas al aire simultáneamente ypara cada moneda se registra si aparece águila osol. ¿Cuál es la probabilidad de que ocurra cada uno de los siguientes eventos?
a) Que es obtengan dos águilas.
b) Que se obtenga al menos un águila. c) Que no es obtenga ninguna águila.

Answers

The probabilities of getting eagles in different quantities, given the number of coins would be:

a) Probability of getting two eagles: 3 / 8b) Probability of getting at least one eagle: 7 / 8c) Probability of no eagle: 1 / 8

How to find the probabilities ?

There are 8 possible outcomes when tossing 3 coins: HHH, HHT, HTH, THH, TTH, THT, HTT, TTT.

The probability of getting 2 eagles is 3/8 because the ways of getting eagles HHH, HHT, and HTH.

The probability of getting at least 1 eagle is 7 / 8. There are 7 ways to get at least 1 eagle: HHH, HHT, HTH, THH, TTH, THT, and HTT.

The probability of getting no eagles is 1/8 / . There is only 1 way to get no eagles: TTT.

Find out more on coins at https://brainly.com/question/30075179

#SPJ9

i need help with the attached questions. thank you

Answers

Yes, because it is practical to obtain that many aspirin because the number is relatively small. The correct option is B.

The minimum sample size required to be 99% confident that the sample standard deviation (s) is within 10% of the population standard deviation (σ) is 336, according to the table provided.

This means that in order to have a high level of confidence (99%) that the sample standard deviation is within a reasonable range of the population standard deviation, a minimum sample size of 336 is needed.

In this case, the sample size requirement is met with a relatively small number, 336, compared to the larger values provided in the table for higher levels of confidence.

Therefore, it can be considered practical to obtain that many aspirin tablets for the purposes of this study.

Thus, the correct option is B.

For more details regarding sample size, visit:

https://brainly.com/question/30100088

#SPJ1

Winona has two jobs; one pays $10.00 per hour and the other pays $9.25 per hour plus an average of 70% of the hourly pay in tips and bonuses. Each pay
period, 20% of her total pay goes to taxes.
Part 1 of 2
(a) Write and simplify an equation that describes Winona's total take-home pay, P, in terms of the number of hours, x, worked at the first job and the
number of hours, y, worked at the second.
The total take-home pay from Winona's two jobs can be found using the equation
P=
Part 2 of 2
X
3
(b) If Winona is committed to work 30 hours per week at the first job, how many hours per week would she need to work at the second job if she needs
her biweekly take-home pay to be $800? Round the answer to one decimal place.
In order for her biweekly take-home pay to be $800, Winona needs to work
hours per week at her second job.

Answers

Answer:

76.5 hours

(If you like this answer i would appreciate if u give brainliest but otherwise, i hope this helped ^^)

Step-by-step explanation:

Part 1 of 2:

(a) The equation that describes Winona's total take-home pay, P, in terms of the number of hours, x, worked at the first job and the number of hours, y, worked at the second job can be written as:

P = (10x) + (9.25y + 0.7 * 9.25y) - 0.2[(10x) + (9.25y + 0.7 * 9.25y)]

Simplifying the equation:

P = 10x + 9.25y + 0.7 * 9.25y - 0.2(10x + 9.25y + 0.7 * 9.25y)

Part 2 of 2:

(b) If Winona is committed to working 30 hours per week at the first job, let's assume x = 30. We need to find the number of hours per week, y, she would need to work at the second job to reach a biweekly take-home pay of $800.

Using the simplified equation from part (a), we substitute x = 30 and solve for y:

800 = (10 * 30) + (9.25y + 0.7 * 9.25y) - 0.2[(10 * 30) + (9.25y + 0.7 * 9.25y)]

800 = 300 + (9.25y + 0.7 * 9.25y) - 0.2(300 + (9.25y + 0.7 * 9.25y))

Now, we can solve for y:

800 = 300 + 9.25y + 0.7 * 9.25y - 0.2(300 + 9.25y + 0.7 * 9.25y)

Simplify the equation:

800 = 300 + 9.25y + 0.7 * 9.25y - 0.2 * 300 - 0.2 * 9.25y - 0.2 * 0.7 * 9.25y

Combine like terms:

800 = 300 - 60 + 9.25y - 1.85y - 0.1295y

800 = 240 + 7.32y

Subtract 240 from both sides:

560 = 7.32y

Divide both sides by 7.32:

y ≈ 76.5

Therefore, Winona would need to work approximately 76.5 hours per week at her second job to reach a biweekly take-home pay of $800.

Amelia runs a day care center. So far this year, the enrollment has consisted of 3 babies and 6 children of other ages. Considering this data, how many of the next 12 children to enroll should you expect to be babies? PLS HURRY

Answers

Answer:

Hope this saved you ^^

Step-by-step explanation:

To determine the number of babies we can expect among the next 12 children to enroll, we need to calculate the proportion of babies based on the current enrollment data.

Out of the total enrollment so far, there are 3 babies and 6 children of other ages, making a total of 9 children.

Proportion of babies = (Number of babies / Total number of children) = 3 / 9 = 1/3

Now, to estimate the number of babies among the next 12 children, we multiply the proportion of babies by the total number of children to be enrolled:

Number of babies expected = Proportion of babies * Total number of children to enroll

Number of babies expected = (1/3) * 12 = 4

Therefore, based on the current enrollment data, we can expect approximately 4 out of the next 12 children to be babies.

A student is given the triangle attached. The student claims that sin(20°)=x/5in. Explain why this reasoning is incorrect.

Answers

The reasoning of the student is wrong because the claim doesn't abide by the sine rule and formula.

What is a sine rule and formula?

The sine rule states that in a triangle, side “a” divided by the sine of angle A is equal to the side “b” divided by the sine of angle B is equal to the side “c” divided by the sine of angle C.

That is;

a/sinA= b/sinB = c/sinC

Therefore, the proper equation to find X = 5/sin98° = X/sin20°

Learn more about sine rule here:

https://brainly.com/question/30401249

#SPJ1

Explain the meaning of the term floor plan in this context​

Answers

floor plan => It is the scale drawing that show the relationship between rooms, spaces, and physical features viewed from the above

THIS PIC WILL ALSO HELP U

what is the value of (-3/4)^-4

Answers

256/81 i think (sorry if it’s wrong)

Answer:

To calculate the value of (-3/4)^-4, we need to apply the exponentiation rules.

When a negative number is raised to an even power, the result is positive. Thus, we can rewrite (-3/4)^-4 as (4/-3)^4.

Now, let's evaluate the expression:

(4/-3)^4 = (4^4)/(-3)^4 = 256/81

So, the value of (-3/4)^-4 is 256/81

Step-by-step explanation:

Find the domain of each expression.

√3 − 6x
√13 − (13 − 2x )
1/√x − 2

Answers

Answer:

To summarize:

√3 - 6x: Domain is all real numbers (-∞, +∞).

√13 - (13 - 2x): Domain is all real numbers (-∞, +∞).

1/√x - 2: Domain is all real numbers except x = 0, represented as (-∞, 0) U (0, +∞).

Step-by-step explanation:

To find the domain of each expression, we need to identify any restrictions or limitations on the variables that would result in undefined values.

√3 - 6x:

Since square roots are defined for non-negative numbers, the expression is defined as long as the value inside the square root (√3) is non-negative. The square root of 3 is a positive value, so there are no restrictions on the domain of this expression. Therefore, the domain is all real numbers (-∞, +∞).

√13 - (13 - 2x):

Similar to the previous expression, the square root (√13) is defined for non-negative values. However, we also need to consider the expression (13 - 2x) inside the parentheses. This expression does not have any limitations since it is defined for all real numbers. Therefore, the domain of this expression is all real numbers (-∞, +∞).

1/√x - 2:

For this expression, we need to consider both the square root (√x) and the denominator (1/√x). The square root (√x) is defined for non-negative values of x. However, the denominator 1/√x will become undefined if the value of x is zero because division by zero is undefined. Therefore, we need to exclude x = 0 from the domain. For all other non-zero values of x, the expression is defined. Therefore, the domain of this expression is all real numbers except x = 0, represented as (-∞, 0) U (0, +∞).

1. Calculate GDP at FC from the following data: GDP at MP = Rs. 2,000 billion Indirect taxes = Rs. 300 billion Subsidies = Rs. 100 billion​

Answers

The GDP at FC from the following data: GDP at MP = Rs. 2,000 billion Indirect taxes = Rs. 300 billion Subsidies = Rs. 100 billion​ is: Rs. 1,800 billion.

What is GDP?

Using this formula to determine the GDP at FC

GDP at FC = GDP at MP - Indirect taxes + Subsidies

Where:

GDP at MP (Market Price) = Rs. 2,000 billion

Indirect taxes = Rs. 300 billion

Subsidies = Rs. 100 billion

Let plug in the formula

GDP at FC = 2,000 billion - 300 billion + 100 billion

GDP at FC = 1,800 billion

Therefore the GDP at factor cost (FC) is Rs. 1,800 billion.

Learn more about GDP here:https://brainly.com/question/1383956

#SPJ1

50 POINTS ANSWER THE LAST QUESTION ON THE CHART AND GIVE ME THE EQUATION FOR BRAINLIST

Answers

Answer:L*W

Step-by-step explanation:

if you look at the pattern you will see that

The figure below represents
marked central angle.
I
of a full circle. Find the measure of the marked central angle.

Answers

The measure of the marked central angle for the given circle is 160°.

Given a part of a circle.

This part is 4/9 of the full circle.

We have to find the marked central angle.

We know that,

Total circle can be represented as,

Total circle = 360°

Since the given figure is 4/9 part of the total circle, the marked central angle will be 4/9 of the total central angle.

Marked central angle = 4/9 × 360

                                    = 160°

Hence the marked central angle is 160°.

Learn more about Central Angles here :

https://brainly.com/question/29150424

#SPJ1

[tex]\\ x^{2} x^{2} x^{2} \sqrt{x}[/tex]

Answers

The expression x²x²x²√x when evaluated is [tex]x^{6\frac{1}{2}}[/tex]

How to evaluate the expression

From the question, we have the following parameters that can be used in our computation:

x²x²x²√x

The above expression can be evaluated using the law of indices

Using the above as a guide, we have the following:

x²x²x²√x = x⁶√x

So, we have

x²x²x²√x = x⁶ * √x

When evaluated, we have

x²x²x²√x =  [tex]x^{6\frac{1}{2}}[/tex]

Hence, the expression when evaluated is [tex]x^{6\frac{1}{2}}[/tex]

Read more about expression at

https://brainly.com/question/15775046

#SPJ1

Complete question

Evaluate x²x²x²√x

Fill in the missing number. % of 800,000 = 208,000

Answers

The percentage is 26%, so the number is 26.

How to find the percenage?

Here we know that the x% of the number 800,000 is equal to 208,000.

Remember that the x% of a number N, is given by the product:

(x%/100%)*N

So in this case we can solve the equation:

(x%/100%)*800,000 = 208,000

Solving that equation for the percentage, we will get:

x% = 100%*(208,000/800,000)

x% = 26%

That is the missing number.

Learn more about percentage at:

https://brainly.com/question/843074

#SPJ1

Other Questions
Noah wants to advertise how many chocolate chips are in each Big Chip cookie at his bakery. He randomly selects a sample of 52 cookies and finds that the number of chocolate chips per cookie in the sample has a mean of 18.5 and a standard deviation of 3.8. What is the 90% confidence interval for the number of chocolate chips per cookie for Big Chip cookies he cash register tape for Swifty Industries reported sales of $27,182.00. Record the journal entry that would be necessary for each of the following situations. (a) Sales per cash register tape exceeds cash on hand by $54.50. (b) Cash on hand exceeds cash reported by cash register tape by $23.50. (List all debit entries before credit entries. Credit account titles are automatically indented when amount is entered. Do not indent manually. Round answers to 2 decimal places, e.g. 52.75.) Which of the following is a possible benefit of the high water content in beer and its diuretic effect?A. It could help prevent the forming of kidney stones.B. It is a psychoactive drug.C. It is a poison. A(n) _______________________ attribute is an attribute with possible values that have a meaningful ranking among them, but the magnitude between successive values is not known. should a restaurant that wants to sell 3000 groupons with a face vale of $75 a $35 each use this tool if groupon charges half of the sales price (keeps half of the $35)? a. yes b. no list three axis powers A man is standing on the shore of a beach, up to his knees in water. Every 5 seconds a wave breaks on him. Calculate the period of the wave. A tennis ball is dropped from 1.0~m1.0 m, bounces off the ground, and rises to 0.85~m0.85 m. What kind of collision occurred between the ball and the ground a fairly common chronic inflammatory disease of the alimentary canal involving all layers of the bowel, which causes chronic diarrhea, is Sales area is a unique combination of _______, _______ and _______. a) sales area, distribution channel, division b) sales organization, plant, division c) sales organization, distribution channel, customer d) sales organization, plant, distribution channel e) sales organization, distribution channel, division Josie is excited to learn that a 5G network is being installed in her area. She recognizes that _____. a. this will increase mobile network latency b. the same antennas already in place for 4G can be reused without modification c. the 5G network will use more energy than the existing 4G network d. this will increase mobile data transfer speeds When is the ap computer science principles create task due 2022. What is the ideal mechanical advantage? if the resistance load is 45.2 n, estimate the effort force required to lift the load. if the effort is applied through a distance of 5 cm, how far will the resistance load move and in which direction? The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(hv^n) is highest. You may wish to use mixMarkov. Bill and Donald entered into a bet on the outcome of the next congressional election in their district. After the election, Bill, who bet on the winner, approached Donald, seeking to collect the $3,000 Donald had wagered. Donald paid Bill the wager but now seeks to recover the funds from Bill. Result? When Raul returns home in the late afternoon after three days of hiking and two nights of sleeping in a sleeping bag, he feels exhausted and immediately gets into his bed and sleeps until the next morning. How would the drive-reduction account of motivation explain Raul's behavior Plot diagram for the great gatsby Create a LunchOrder application that prompts the user for the number of hamburgers, salads, french fries, and sodas and then displays the total for the order. The LunchOrder application should include a: Assume that in humans there is a 50/50 chance that a child will be a boy. If a certain mother and father have four sons, what are the chances that their fifth child will be a daughter Check digits are the only type of validity check that is NOT able to validate data accuracy. Group of answer choices True False