Answer:
AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG
Explanation:
this is the complementary strand for the mRNA.
A=U
C=G
G=C
T=A
this is the key for any mRNA strand.
;)
I NEEEEEEDDDD HEEELPPPPP PLEASEE
Answer:
1/4 = 25%
Explanation:
AO x BO = 1 AB, 1 AO, 1 BO, 1 OO
Why might people use solar energy for their homes?
Answer:
There are many reasons why homeowners go solar, but improving the environment and cutting energy costs are the most common. Many people are aware that solar is a great home efficiency upgrade and are eager to reduce their carbon footprint while also improving property value.
Explanation:
Describe the impact of technology on the environment today.
Answer:
These mainly occur as a result of agriculture, mining, water usage and consumption of fossil fuels, all of which have been enabled by advancements in technology. Due to the increasing global population, levels of natural resource degradation are also increasing.
Answer:
technological advancements had lead to the industrial society, which has greatly increased pollution and habitat destruction. however, today technology is being utilized to reduce human impact on the environment.
Explanation: its the possible answer on edge 2021
what products are yielded during electron transfer in cellular respiration?
Answer:
ATP, Carbon dioxide, and water?
Explanation:
Image does not belong to me.
what is the four chambers for the heart?
Answer:
The heart has four chambers: two atria and two ventricles.
Explanation:
The right atrium receives oxygen-poor blood from the body and pumps it to the right ventricle. The right ventricle pumps the oxygen-poor blood to the lungs. The left atrium receives oxygen-rich blood from the lungs and pumps it to the left ventricle.
Answer:
The four chambers of the heart are the Right atrium,Left atrium,Right ventricle and Left ventricle.
Explanation:
Have a great day♡
TO PLZ HELP!!!!
List five organelles eukaryotes have that prokaryotes do not have.
Answer:
nucleus, mitochondria, golgi apparatus, endoplasmic reticulum and lysosomes
Which of the following would likely move through the phospholipids of the
cell membrane most easily? *
CO2
Glucose
K+
Starch
Answer:
CO2
Explanation:
Oxygen and CO2 can move through the cell membrane through simple diffusion because they are small molecules.
It's possible that CO2 travels through the lipid bilayer far more quickly than any other molecule. Therefore, option (A) is correct.
What is the structure of cell membrane ?According to the fluid mosaic model, the plasma membrane is a mosaic of components—primarily, phospholipids, cholesterol, and proteins—that move freely and fluidly in the plane of the membrane.
All cells have a cell membrane, also known as a plasma membrane, which separates the interior of the cell from the external environment. A semipermeable lipid bilayer makes up the cell membrane. The movement of materials into and out of the cell is controlled by the cell membrane.
Therefore, small and simple molecules like water, H2O , CO2 can pass through the cell membrane easily as it is partially permeable.
Learn more about cell membrane, here:
https://brainly.com/question/13524386
#SPJ6
Describe THREE examples of the effect of altitude on animals.(life science)
Altitude is an elevation from the sea level. It plays an important role in animals as it affects the respiratory rate, pressure on the cells, and homeostasis.
What is the respiratory rate?Respiratory rate is the breathing that involves the inhalation and exhalation of gases through the respiratory system. The breathing rate is reduced due to decreases in oxygen transport at a higher altitude which causes fatigue.
At higher altitudes, the pressure is more and in turn, affects the cells as the body also maintains an osmotic pressure to balance the fluid and internal organs. As the altitude increases the temperature drops which affects the homeostasis of the body resulting in more use of energy to keep warm.
Therefore, altitude affects respiration, cell pressure, and homeostasis.
Learn more about respiratory rate here:
https://brainly.com/question/13139675
#SPJ2
helppp pleasee!!!!!!
Answer:
last option is a correct answer.
Explanation:
the moon and the earth spin around each other.
Hope this helps!
The breathing rate , heart rate , and blood hormone levels of an individual would directly provide information about that individuals ?
Answer:
Health
Explanation: Knowing an individuals breathing rate heart rate and or blood hormone levels could help you find weather or not that person has any heart problems or just health problems in general. Hope this helped :)
20
Which type of molecule is pictured? *
(1 Point)
carbohydrate
lipid
nucleic acid
O protein
The type of molecule pictured here is a lipid.
which answer is correct, ( i inserted a picture) please help ill give brainliest if correct
Answer:
D
Explanation:
Bohr determined that there are discrete (unique, different from one another) energy levels in the atom and that electrons will orbit the nucleus within these energy levels, known as orbitals.
please help please i really need it
Answer:
b
Explanation:
Answer:
with what??? :(
Explanation:
All of the organisms in the domain Archaea are
A. prokaryotes
B. eukaryotes
C. autotrophs
D. multicellular
All of the organisms in the domain Archaea are prokaryotes.
Archaea are unicellular organisms with no nuclei, hence are prokaryotes.
Characteristics of Archaea Greek word Archaios means ancient.They are unicellular organisms that resemble bacteria and have some similarity to eukaryotes.Hence a third domain Archaea was introduced by Carl Woese based on ribosomal RNA analysis.They can live in extreme conditions like higher temperature, higher cold regions etc.To learn more about prokaryotes :
https://brainly.com/question/1288013
#SPJ2
Modern classification is based on
A. structural similarities
B. Biochemical evidence
C. evolutionary relationships
D. analogous structures
Answer:
A. structural similarities
Explanation:
Answer:
A. structural similarities
Explanation:
Hope this will help
Adelaide and Emma Rose created two brand new breeds of flowers: one lime green (G) and one bright orange (O). Green is codominant with orange. If they cross a lime green flower with a bright orange flower, what percentage will be speckled?
Answer:
20%
Explanation:
hope it helps
Adelaide and Emma Rose created two brand-new breeds of flowers: one lime green (G) and one bright orange (O). The percentage that will be speckled is 20%.
What is crossing over?When chromosomes of the same type are paired together during meiosis, a biological event called crossing over takes place. Parts of the chromosome can be exchanged when two chromosomes, one from the mother and one from the father, line up.
The same genes may be present on the two chromosomes in different versions. The genetic material in the germ line can switch places, a process is known as crossing over.
Pairs of chromosomes from each parent align to allow similar DNA sequences from the paired chromosomes to cross over one another during the development of egg and sperm cells, commonly known as meiosis.
Therefore, the percentage that will be speckled is 20%.
To learn more about crossing over, refer to the link:
https://brainly.com/question/27256451
#SPJ2
WILL GIVE BRAINLIEST
a natural hazard is best defines as _____.
a.) any hazardous event that requires the declaration of a national state of emergency
b.) any large disaster that requires large amount of money and time for recovery
c.) any natural event that requires international assistance and aid
d.) any natural process that threatens human property and human lives
Answer:
D. any natural process that threatens human property and human lives.
Which is an extreme disturbance to any ecosystem
Answer:extreme temperature change
Explanation:
I took the quick check
Will Betelgeuse become a Neutron star or Black hole?
☁️ Answer ☁️
Scientists believe that Betelgeuse will most likely become a neutron star after it goes through a supernova event.
Hope it helps.
Have a nice day noona!~ ￣▽￣❤️
I NEED HELPPP PLZZZZZZZZZZZZZZZZZ
Please Answer These Questions!
1. What is a stimulus?
2. Why does the body respond to stimuli?
3. What are some different types of stimuli?
4. What are sensory organs and what type of stimuli do these receptors respond to?
5. What is an explanation of how the information from stimuli is communicated to the brain?
6. What is a description of the two things that can happen when the brain processes the information from stimuli?
Hello, 3Coli Here!
Here are your answers:
1. What is a stimulus?
Stimulus is a natural body reaction caused by changes in the environment around or inside the organism. This is a response from the brain.
2. Why does the body respond to stimuli?
The body responds to stimuli, because it needs to protect itself.
3. What are some different types of stimuli?
The two main types of stimuli are external stimuli and internal stimuli. External stimuli are reactions triggered by changes that occur outside of the body, while internal stimuli are reactions triggered by changes inside of the body.
4. What are sensory organs and what type of stimuli do these receptors respond to?
The most commonly used sensory organs include Eyes, Ears, Tongue, Nose, and Skin. Eyes respond to light and motion, because they are used to see. Ears respond to sound, because they hear. The tongue is used to taste, so it senses flavors. The nose is used to smell, so it responds to scents. Finally, the skin is used to feel, so it responds to whatever it feels.
5. What is an explanation of how the information from stimuli is communicated to the brain?
Neuron receptors convert internal and external environments into electrical signals, and then is sent to the brain through nerves.
6. What is a description of the two things that can happen when the brain processes the information from stimuli?
After the brain receives the signal, it will provide a response. One type of response is that the body will physically react to the change. The second type of response is to avoid the change.
Hopefully, this helps! :D
Ask your question below!
Which is the link between fossil fuel use and flowers blooming earlier in the spring season?
A. A warmer Earth due to fossil fuel emissions has milder winters and earlier springs.
B. Fossil fuel emissions contain compounds that are fertilizers.
C. Spring seasons are cooler due to increased fossil fuel emissions.
D. Increased greenhouse gases due to fossil fuel emissions allows more sunlight to reach Earth.
How can humans best limit the negative impact that farming has on soil quality?
Answer:
rasenshuriken jk f these resources, soil and water have provided humans with the ability to ... to fertile soils; 3) the impacts of intensive agriculture on soil degradation; and 4) the ... in a severe limitation of crop yield — an example of the principle of limiting factors. ... to generate new soil, it is imperative that agricultural practices utilize best ...
Explanation:
Help me pleeeeeaaasssseeee
True or False
Continental drift is the theory that states that the continents were separate and then slowly drifted together to form single landmass
hello help please i’ll mark brainliest!!!
Which of the following functions belongs
to the cellular membrane?
A. keeps the organelles in place
B. protects the cells from its surroundings
C. acts as an "ID card" for cells
D. allows large molecules to move from one side of a cell
Answer:
I believe B would be the answer
Answer:
B. protects the cells from its surroundingsExplanation:
How do you think the Law of Universal Gravitation State connects why apples fall down and planets circle in orbit?
which of the following would be considered a healthy pattern of weight gain in a pregnant woman?
Answer:
Underweight women should gain 28 to 40 pounds. And overweight women may need to gain only 15 to 25 pounds during pregnancy. In general, you should gain about 2 to 4 pounds during the first three months you're pregnant and 1 pound a week during the rest of your pregnancy.
ill give brain thing to first answer
Speciation, which leads to diversity among species through natural
selection, occurs when
Once similar species are no longer able to mate and produce fertile
offspring
Organisms develop characteristics that mimic traits of a completely
different species.
Species experience change within their lineage and develop new
characteristics.
Species interact with other species in an ecosystem and develop
similar traits to each other.
Answer:
Natural selection and speciation: 'Ecological speciation'. ... Natural selection is generally recognized as a central mechanism of evolutionary change within species. Thus, natural selection plays a major role in generating the array of phenotypic and genetic diversity observed in nature.