Using first the customary ruler and then the metric

ruler, measure the length of the side of the wooden

block. remember to estimate to one place value

beyond the rulers' gradations.

1 3/32 in inches

y 2.78 cm centimeter

complete

calculate ratios for the number of centimeters in

an inch and the number of inches in a centimeter:

cm in or in/cm

1

hength

done

Answers

Answer 1

The number of centimeters in an inch is approximately 2.54, while the number of inches in a centimeter is approximately 0.39.

Using the customary ruler, the length of the side of the wooden block is measured as 1 3/32 inches.

This means the length is slightly over 1 inch but less than 1 1/8 inches.

To estimate one place value beyond the ruler's gradations, we can round the measurement to 1.1 inches.

Using the metric ruler, the length is measured as 2.78 centimeters. This measurement provides a more precise value in the metric system.

To calculate the ratio between centimeters and inches, we find that there are approximately 2.54 centimeters in an inch.

This means that for every 1 inch, there are approximately 2.54 centimeters.

Conversely, there are approximately 0.39 inches in a centimeter.

This means that for every 1 centimeter, there are approximately 0.39 inches.

In conclusion, the length of the wooden block's side is measured as 1.1 inches using the customary ruler and 2.78 centimeters using the metric ruler.

The conversion ratios between centimeters and inches are approximately 2.54 cm/inch and 0.39 inch/cm, respectively.

These ratios can be used to convert measurements between customary and metric systems.

To learn more about customary ruler click here: brainly.com/question/2590752

#SPJ11


Related Questions

As the CEO of Blue Corp., George makes it a point to meet new hires at all levels of his organization. He explains the goals of the company and emphasizes on the importance of an individual employee's role in the larger picture. This initiative of George focuses on the _____ of performance management.

Answers

George's initiative of meeting new hires and emphasizing the goals of the company and individual employee roles aligns with the developmental aspect of performance management.

Performance management encompasses various activities aimed at improving employee performance and aligning it with organizational goals. One key aspect of performance management is the developmental approach, which focuses on developing employees' skills, knowledge, and capabilities to enhance their performance and contribute to the overall success of the organization.

This approach not only helps employees feel valued and motivated but also creates a sense of purpose and alignment with the company's objectives. By actively engaging with new hires and providing them with a broader context, George is fostering a culture of continuous learning and development, which can lead to improved performance and organizational success.

Learn more about approach here:

https://brainly.com/question/30967234

#SPJ11

The total length of a road trip was 16.2 hours. If highway signs are posted every 0.6 hours, including one at the end of the road trip, how many highway signs will there be on the road trip?

Answers

Answer:

To find the number of highway signs on the road trip, we need to divide the total length of the trip by the time between each sign, including the last one.

First, we need to find out how many signs are posted during the trip. To do this, we can divide the total length of the trip by the time between each sign:

16.2 / 0.6 = 27

So there will be 27 signs posted during the trip, including one at the end.

Therefore, there will be 27 highway signs on the road trip.

Please Help!!

4 Find the total surface area of the figure below.
14 mm
38 mm
13 mm
23 mm

Answers

Answer: 1891 mm^21

Step-by-step explanation:

The _______________ is a nationwide network jointly operated by the Fed and private institutions that electronically process credit and debit transfers of funds. Multiple Choice

Answers

A. Fedwire. a nationwide network jointly operated by the Fed and private institutions that electronically process credit and debit transfers of funds.

What is fedwire?

Fedwire is a nationwide network jointly operated by the Federal Reserve System (Fed) and private financial institutions. It facilitates the electronic processing and settlement of high-value and time-sensitive transfers of funds, including credit and debit transactions. Fedwire enables participants to transfer funds securely and in real-time, providing a crucial infrastructure for interbank transfers and large-scale financial transactions within the United States.

1. Role and Function: Fedwire, also known as the Federal Reserve Wire Network, serves as a critical payment system in the United States. It enables the secure and immediate transfer of funds between participating financial institutions. Fedwire processes various types of transactions, including interbank transfers, securities transactions, government payments, and large-value commercial transactions.

2. Operation: The Federal Reserve operates the Fedwire system in partnership with private financial institutions, such as banks and credit unions. It provides a reliable and secure infrastructure for financial institutions to initiate and settle payments electronically.

Learn more about fedwire here:

https://brainly.com/question/31386768

#SPJ4

The complete question is:

The Fed and commercial banks jointly run a national network called the _______________ to process credit and debit transactions of money electronically.

A. Fedwire

B. ACH

C. CHIPS

D. NASDAQ

E. SWIFT

An increase in temperature increases the reaction rate becauseGroup of answer choicesa greater fraction of the collisions have the correct orientation of molecules.the activation energy of the reaction will increase.the activation energy of the reaction will decrease.temperature acts as a catalyst in chemical reactions.more collisions will have enough energy to exceed the activation energy.

Answers

An increase in temperature increases, "reaction-rate" because (e) more collisions will have enough energy to exceed "activation-energy".

An increase in the temperature increases the "reaction-rate" because more collisions between molecules will have enough energy to exceed the "activation-energy" required for the reaction to occur.

When temperature increases, the "kinetic-energy" of molecules also increases. This leads to faster and more energetic molecular motion, resulting in a greater number of collisions between reactant molecules.

Therefore, the correct option is (e).

Learn more about Reaction here

https://brainly.com/question/4414167

#SPJ4

The given question is incomplete, the complete question is

An increase in temperature increases the reaction rate because

(a) a greater fraction of the collisions have the correct orientation of molecules.

(b) the activation energy of the reaction will increase.

(c) the activation energy of the reaction will decrease.

(d) temperature acts as a catalyst in chemical reactions.

(e) more collisions will have enough energy to exceed the activation energy.

Waterway Industries reported income taxes of $418,100,000 on its 2022 income statement and income taxes payable of $313,010,000 at December 31, 2022, and $596,640,000 at December 31, 2022. What amount of cash payments were made for income taxes during 2022

Answers

Waterway Industries made cash payments of $124,130,000 for income taxes during 2022.

To determine the cash payments made for income taxes during 2022, we need to consider the change in income taxes payable from the beginning to the end of the year. The change in income taxes payable represents the net increase or decrease in the amount owed to tax authorities. In this case, the income taxes payable at the beginning of the year (December 31, 2021) was $313,010,000, and the income taxes payable at the end of the year (December 31, 2022) was $596,640,000. Therefore, the change in income taxes payable is calculated as follows:

Change in income taxes payable = Income taxes payable at December 31, 2022 - Income taxes payable at December 31, 2021

= $596,640,000 - $313,010,000

= $283,630,000

The change in income taxes payable represents the amount of income taxes that were paid during 2022. Thus, Waterway Industries made cash payments of $283,630,000 for income taxes during the year.

Learn more about payments here:

https://brainly.com/question/31514256

#SPJ11

a charged particle moves into a region of uniform magnetic field , goes through half a circle, and then exits that region. The particle is either a proton or an electron (you must decide which). It spends 130 ns in the region. (a) What is the magnitude of

Answers

The magnitude of the charge on the particle cannot be determined with the given information.

In the context of a charged particle moving in a magnetic field, the magnitude of the charge on the particle is a crucial factor in determining its behavior.

However, the given information does not provide any details or measurements related to the charge of the particle. Therefore, it is not possible to determine the magnitude of the charge based on the given information alone.

To calculate the magnitude of the charge, additional information such as the radius of the circular path, the strength of the magnetic field, or the mass of the particle would be required. Without this additional information, it is not possible to determine the magnitude of the charge on the particle.

Learn more about proton here : brainly.com/question/1176627

#SPJ11

involves providing financial aid, material resources, or needed services. Esteem support Informational support Social companionship Instrumental support Global support

Answers

Providing support can take various forms, including financial aid, material resources, or needed services. It encompasses esteem support, informational support, social companionship, instrumental support, and global support.

Support can be broadly categorized into different types based on the nature of assistance provided.Esteem support refers to actions that boost someone's self-esteem, confidence, and sense of self-worth. It involves offering encouragement, praise, and recognition to uplift individuals emotionally and validate their accomplishments.

Informational support involves providing knowledge, advice, and guidance to help individuals make informed decisions or solve problems. This type of support may include sharing information, offering suggestions, or directing someone to relevant resources.

Social companionship support entails being there for someone as a friend, confidant, or companion. It involves spending time together, engaging in activities, and providing emotional reassurance through empathetic listening and understanding.

Instrumental support focuses on providing tangible assistance and resources to meet practical needs. This can include financial aid, offering transportation, helping with household tasks, or providing access to necessary services.Global support extends beyond individual or local contexts and involves contributing to global causes or initiatives. It may involve participating in philanthropic efforts, advocating for social justice, or supporting environmental sustainability.

By understanding and addressing the diverse aspects of support, individuals and communities can effectively meet the needs of others and foster overall well-being.

Learn more about global here:

https://brainly.com/question/28983838

#SPJ11

Labor laws in Europe ______________ laying off or firing current workers compared to labor laws in the U.S. Therefore, the natural rate of unemployment in Europe is likely to be higher than the natural rate of unemployment in the U.S.

Answers

Labor laws in Europe impose stricter regulations on laying off or firing current workers compared to labor laws in the U.S. As a result, the natural rate of unemployment in Europe is likely to be higher than the natural rate of unemployment in the U.S.

Labor laws vary across countries and can significantly impact employment practices and labor market dynamics. In Europe, labor laws generally provide stronger interest for workers, making it more challenging for employers to lay off or fire current employees. These laws often include stricter requirements for severance pay, notice periods, and legal justifications for termination.

As a consequence, the higher level of job security and legal protections for workers in Europe may create higher barriers for employers to adjust their workforce according to economic conditions. This can lead to reduced flexibility in the labor market, making it more difficult for employers to adapt to changing business needs or economic downturns.

Learn more about interest here:

https://brainly.com/question/30955042

#SPJ11

ommon resources tend to be overused because: Group of answer choices the marginal cost of allowing one more unit of consumption is zero. the individual marginal cost is greater than the marginal social cost. individuals tend to ignore the cost their use of the resource has on others. common resources are nonrival and nonexcludable.

Answers

A individuals tend to ignore the cost their use of the resource has on others,  to the overuse of common resources.

1)The individual marginal cost is greater than the marginal social cost: This situation would lead to underuse or suboptimal allocation of resources, rather than overuse.

2)Individuals tend to ignore the cost their use of the resource has on others.

Common resources, also known as common-pool resources, are typically characterized by being nonexcludable and rivalrous . Due to these characteristics, common resources are prone to overuse or depletion.

One of the key reasons common resources are overused is that individuals tend to ignore the cost their use of the resource has on others. Since the marginal cost of consuming one more unit of the resource is often low or perceived as zero, individuals may prioritize their immediate benefits without considering the long-term consequences for the resource or other people who depend on it.

3)The other options listed in the question are not directly related to the overuse of common resources:

The marginal cost of allowing one more unit of consumption is zero.While this may contribute to the overuse of common resources, it is not the primary reason. The zero marginal cost implies that individuals can consume additional units without incurring extra costs, but it does not address the issue of ignoring the cost on others.

4)Common resources are nonrival and nonexcludable:

These characteristics define common resources but do not directly explain  they are overused. The overuse arises from the behaviour of individuals and their disregard for the costs imposed on others.

To know more about cost here

https://brainly.com/question/17120857

#SPJ4

g On a system whose cache stores 4 integers per cache block, we run a program that accesses each element of a very long integer array in sequence. Assuming the cache is initially empty, what is the expected miss rate for accesses to this array

Answers

Given a system with a cache that stores 4 integers per cache block, and assuming the cache is initially empty, we need to determine the expected miss rate for accessing each element of a long integer array in sequence.

Since the cache can store 4 integers per cache block, when the program accesses the first element of the array, it will result in a cache miss since the cache is initially empty. This miss will bring the entire cache block containing the accessed element into the cache. Subsequent accesses to the next three elements of the array will be cache hits, as they are present in the same cache block. However, when the program accesses the fifth element, it will result in another cache miss, as it belongs to a different cache block.

This pattern repeats for every subsequent element of the array. For every fourth element, a cache miss occurs because a new cache block needs to be loaded. Therefore, the expected miss rate for accessing this array is 25%. This means that for every four memory accesses, one will result in a cache miss, while the other three will be cache hits, assuming a sequential access pattern.

In summary, with a cache storing 4 integers per cache block and an initially empty cache, the expected miss rate for accessing each element of the array in sequence is 25%. This is because a cache miss occurs for every fourth element, resulting in the need to load a new cache block. The other three elements within the same cache block will be cache hits.

Learn more about initially here:

https://brainly.com/question/32209767

#SPJ11

Based on a survey, a grocery store claims that 97% of their customers prefer the store’s brand of milk to the other available brands. Out of 210 customers, how many would you predict will prefer the store’s brand of milk?

Answers

Answer:

6 people

Explanation

First step would be to change the % into a number to help us out.

97% = 97/ 100 = 0.97

after that we need to multiply by the total number of costumers

210 x 0.97 = 203.7

since you cant have a 0.7 part of a person we say 204 will buy the store brand milk

after that we subtract the total costumers from the store brand costumers and we get our answer

210 -204 = 6

Under the consent once removed exception, officers cannot make a warrantless entry to arrest a suspect if consent to enter was given earlier to an undercover officer or informant. Group of answer choices True False

Answers

The statement, "Under consent once removed-exception, officers cannot make a "warrantless-entry" to arrest suspect" is False because officers can make a warrantless entry.

This exception allows law enforcement officers to rely on the consent initially given by the suspect to the undercover officer or informant as a basis for making a warrantless entry to effectuate an arrest.

The rationale behind this exception is that the suspect's consent remains valid even if it was given to someone acting undercover or in an informant capacity.

Therefore, the statement that officers cannot make a warrantless entry under the consent once removed exception is false.

Learn more about Arrest here

https://brainly.com/question/10392676

#SPJ4

In , both feet can be off the ground at once. To avoid full impact on the joints, use . can be a better activity type for overweight individuals. increase(s) the number of calories used in a workout. Running is an example of . Short, high intensity segments included in a workout is/are called .

Answers

Introducing short, high-intensity segments in a workout is called interval training. This method can help boost calorie expenditure and improve overall fitness.

When engaging in running, there are moments during the running gait cycle where both feet are off the ground simultaneously. This phenomenon is known as the flight phase. Running is considered a high-impact activity, which means it puts stress on the joints, especially for individuals who are overweight or have joint-related issues. To mitigate this impact, low-impact exercises such as swimming or cycling can be more suitable for overweight individuals as they provide cardiovascular benefits with reduced stress on the joints.

While running may not be the ideal choice for overweight individuals concerned about the joint impact, it can be advantageous for increasing the number of calories burned during a workout. Running is a weight-bearing exercise that engages multiple muscle groups and requires more energy expenditure compared to low-impact exercises. This increased calorie burn can be beneficial for weight loss and improving cardiovascular fitness.

Interval training refers to a workout method that involves alternating periods of high-intensity exercise with periods of low-intensity or rest. This technique can be applied to various exercises, including running. By incorporating short, high-intensity segments, such as sprinting or running at a faster pace, into a workout, individuals can challenge their cardiovascular system, improve endurance, and burn more calories in a shorter amount of time. Interval training is known for its efficiency and effectiveness in boosting overall fitness levels.

To learn more about Interval training click here: brainly.com/question/13003179

#SPJ11

Work out the volume of this sphere.
Give your answer to 1 decimal place.
1
1
I
4.7 cm
Spheres
Vol = ²

Answers

Answer:

≈ 434.9

-------------------------------------------------------------------------------------------------------------

Assuming 4.7 cm is the radius we will use the sphere volume formula

Plugging into in the equation

[tex]\frac{4}{3}[/tex] π [tex]r^{3}[/tex]

[tex]\frac{4}{3}[/tex] π (4.7)³

Solve

≈ 434.9

How many nontraditional credit references are r

Answers

50% οr less οf qualifying incοme, at least twο credit references fοr each bοrrοwer withοut a credit scοre.

How is non-traditional credit calculated?

The number οf nοn-traditiοnal credit references required fοr a bοrrοwer with nο credit scοre can vary depending οn the lender and their specific requirements. Generally, lenders may ask fοr alternative credit references tο assess the bοrrοwer's creditwοrthiness in the absence οf a traditiοnal credit scοre. These alternative references cοuld include:

Rental payment histοry: Prοviding evidence οf οn-time rental payments and a gοοd rental histοry can serve as a pοsitive credit reference.

Utility bills: Shοwing cοnsistent and timely payment οf utility bills such as electricity, water, οr gas can demοnstrate respοnsible financial behaviοr.

Cell phοne bills: Submitting prοοf οf regular and timely payments fοr cell phοne bills can be cοnsidered as a credit reference.

Bank statements: Prοviding bank statements that shοw regular depοsits, savings, and respοnsible mοney management can be used as a credit reference.

Emplοyment histοry: Demοnstrating a stable emplοyment histοry and prοviding emplοyment verificatiοn can be cοnsidered as a nοn-traditiοnal credit reference.

Learn more about nontraditional credit

https://brainly.com/question/32479921

#SPJ4

Complete question:

How many non traditional credit references are required for a borrower with no credit score?

In circle F with mZEFG = 36 and EF = 11 units, find the length of arc EG.


Round to the nearest hundredth.


F


E


G

Answers

The length of arc EG is 6.908 units.

What is an arc length of a circle?

The arc length of a circle is the distance between two points on the curve of the circle.

Arc length = θ/360 of 2πr = θ/360 × 2πr = rθ × π/180.

We have the information from the question is:

In circle,

EF = r = 11 units

m ∠EFG = angle = 36

We have to find the length of arc EG

Substituting the values in the formula.

Arc length = (angle/360) x (2πr)

                 = 36/360 x 2π x 11

                 = 6.908

Thus, The length of arc EG is 6.908 units.

Learn more about Length of arc at:

https://brainly.com/question/31762064

#SPJ4

Puzzle one
determine if the following relations are functions or not. to
break the code each function has a value of 4 and each non-
function has a value of 8. find the product of all the odd
problems and the product of all the even problems, then find
the difference of the two products to break the code!

Answers

Relations 1 and 7 are not a function and relations 2, 3, 4, 5, 6 and 8 are functions. The product of all the odd problems and the product of all the even problems are 1024 and 256 simultaneously.  The difference of the two products to break the code is 768.

A function from set A to set B is a mapping from A to B which maps each and every element in A uniquely to set B.

It is not a function because 4 is getting mapped to a and c both. Value = 8It is a function because each element of {1, 2, 3, 4} is getting mapped uniquely to {a, b, c}. Value = 4Yes, It is a function. Value = 4Yes, It is a function. Value = 4Yes, It is a function. Value = 4Yes, It is a function. Value = 4No, it is not a function the point maps to 2 different values in y. Value = 8Yes, it is a function. Value = 4

Product of odd problems = 8 x 4 x 4 x 8 = 1024

Product of even problems = 4 x 4 x 4 x 4 = 256

Difference = 1024 - 256 = 768

Know more about functions and relations,

https://brainly.com/question/24779057

#SPJ1

Using the number of minutes per call in last month's cell phone bill, David calculated that upper quartile to be 19 minutes and the lower quartile to be 12 minutes. Any value greater than ______ minutes is an outlier
a.) 19 b.) 10.5 c.) 29.5 d.) 26

Answers

Any value greater than 29.5 minutes would be considered an outlier in this scenario.

What is outlier limit?

The outlier limit is a threshold used to determine whether a data point is considered an outlier or not. It is calculated based on the concept of the interquartile range (IQR), which is a measure of the dispersion or spread of a dataset.

In this case, the upper quartile is 19 minutes and the lower quartile is 12 minutes. To identify outliers, we can use the interquartile range (IQR), which is the difference between the upper quartile and the lower quartile.

IQR = Upper Quartile - Lower Quartile

IQR = 19 - 12 = 7

According to the definition of outliers, any value that is more than 1.5 times the IQR above the upper quartile or below the lower quartile can be considered an outlier.

Upper Outlier Limit = Upper Quartile + (1.5 * IQR)

Upper Outlier Limit = 19 + (1.5 * 7) = 19 + 10.5 = 29.5

Therefore, any value greater than 29.5 minutes would be considered an outlier in this scenario.

The correct answer is (c) 29.5.

To know more about outlier limit visit:

https://brainly.com/question/31379947

#SPJ4

why are cool mist vaporizers rather than steam vaporizers recommended in the home treatment of respiratory infections

Answers

Cool mist vaporizers are recommended over steam vaporizers in the home treatment of respiratory infections due to their safety and effectiveness in providing relief for respiratory symptoms.

Cool mist vaporizers produce a fine mist without heating the water, making them safer to use, especially around children or pets. They do not carry the risk of burns or accidental spills associated with steam vaporizers, which heat water to produce steam. The cool mist generated by these devices helps soothe and moisturize the respiratory passages, reducing irritation and easing congestion. Additionally, cool mist vaporizers are more effective in humidifying the air, as they disperse tiny water droplets that evaporate quickly, increasing the moisture content in the environment. This increased humidity can help alleviate dryness in the nasal passages and throat, making it easier to breathe and reducing discomfort caused by respiratory infections. Cool mist vaporizers are also beneficial in situations where steam vaporizers may exacerbate certain conditions, such as asthma or allergies. The warm steam produced by steam vaporizers can sometimes trigger or worsen respiratory symptoms in individuals with these conditions, while cool mist vaporizers provide a gentler and more suitable option for humidifying the air without causing additional irritation.

Learn more about respiratory symptoms here:

https://brainly.com/question/29534655

#SPJ11

__________, the decision to arrest someone or even to ignore a matter, is a routine part of police work. Group of answer choices medicalization of deviance recidivism police corruption police discretion

Answers

The term that best fits the description provided is "police discretion."

Police discretion refers to the authority and freedom given to law enforcement officers to make decisions and exercise judgment in carrying out their duties. It involves the ability of police officers to choose how to respond to various situations, including whether to make an arrest, issue a warning, or ignore a matter altogether.

Police officers often encounter a wide range of situations in their work, and not all incidents may require immediate arrest or intervention. Factors such as the severity of the offence, the individual's behaviour, the presence of mitigating circumstances, and the officer's professional judgment all come into play when exercising discretion.

Police discretion plays a significant role in maintaining order and managing limited resources effectively. It allows officers to prioritize their actions, allocate their time and energy appropriately, and respond to the unique circumstances they encounter on a daily basis.

However, the exercise of police discretion is not without challenges. It can lead to inconsistencies, potential biases, or even cases of corruption if used improperly.

Therefore, appropriate oversight, training, and accountability measures are necessary to ensure that police discretion is used responsibly and in line with legal and ethical standards.

To learn more about police discretion from the given link

https://brainly.com/question/1129992

#SPJ4

The diameter of a circle is 18 kilometers. What is the circle's circumference use 3.14 for n

Answers

Answer:

56.52km

Step-by-step explanation:

Circumference = π X D (D = diameter = 2 X radius)

= (3.14) X 18

= 56.52 km

For the month of June in a certain city, 87% of the days are cloudy. Also in the month of June in the same city, 73% of the days are cloudy and foggy. What is the probability that a randomly selected day in June will be foggy if it is cloudy

Answers

The probability that a randomly selected day in June will be foggy if it is cloudy can be determined by calculating the conditional probability of foggy days given cloudy days.

Let's denote the events as follows: C represents a cloudy day, and F represents a foggy day. We are given that the probability of a day being cloudy is 0.87 (87%) and the probability of a day being both cloudy and foggy is 0.73 (73%).

To find the probability of a day being foggy given that it is cloudy, we use the formula for conditional probability:

P(F | C) = P(F and C) / P(C)

In this case, P(F and C) represents the probability of a day being both foggy and cloudy, which is given as 0.73 (73%), and P(C) represents the probability of a day being cloudy, which is given as 0.87 (87%).

Therefore, the probability of a randomly selected day in June being foggy if it is cloudy can be calculated as:

P(F | C) = 0.73 / 0.87 ≈ 0.839

Learn more about probability here:

https://brainly.com/question/31828911

#SPJ11

Graph the line that represents this equation:

Y=-5x+2



Drawing Tools.

Answers

The graph of the equation is attached.

We can use the slope-intercept form, which is y = mx + b, where m is the slope and b is the y-intercept, to graph the line represented by the equation y = -5x + 2.

The slope (m) in this situation is -5, while the y-intercept (b) is 2.

The y-intercept, or point (0, 2), can be used as the starting point for the line's plot.

The slope can then be used to locate other locations along the line.

The -5 slope indicates that the y-coordinate declines by 5 units for every unit increase in the x-coordinate.

Let's plot a few more points using this information:

When x = 1:

y = -5(1) + 2

y = -5 + 2

y = -3

So the point (1, -3) lies on the line.

When x = -1:

y = -5(-1) + 2

y = 5 + 2

y = 7

So the point (-1, 7) lies on the line.

Potting the points we will join the line, the line obtained will be a straight line representing the equation y = -5x+2.

Learn more about graph click;

https://brainly.com/question/17267403

#SPJ1

2(x+3)x-4 what is x?

Answers

Answer:

x=-3 or 4

Step-by-step explanation:

2(x+3)(x-4)

(2x+6)(x-4)

2x(x-4)+6(x-4)

2x²-8x+6x-24

2x²-2x-24=0. (quadratic equation)

using almighty formula

X1=-3

X2=4

Answer:

2(×±3)×-4. the answer is below

x1=3

x2=4

2

what are all the values of c that will make x^2 cx 121 a perfect square ?

Answers

Answer:

c = -22, 22

Step-by-step explanation:

[tex] {(x - 11)}^{2} = {x}^{2} - 22x + 121[/tex]

[tex] {(x + 11)}^{2} = {x}^{2} + 22x + 121[/tex]

a company owns two dealerships, both of which sell cars and trucks. the first dealership sells a total of 164 cars and trucks. the second dealership sells twice as many cars and half as many trucks as the first dealership, and sells a total of 229 cars and trucks. an equation for the total cars and trucks for dealership a: an equation for the total cars and trucks for dealership b: how many cars did dealership a sell? how many trucks did the dealership b sell?

Answers

a) An equation for the total cars and trucks for the dealership is y = 2x + 0.5y = 229. b) Dealership B did not sell any cars and Dealership A sold 164 cars.

Let's say that the number of cars and trucks sold by dealership A is 'x', and the number of cars and trucks sold by dealership B is 'y'.

An equation for the total cars and trucks for dealership A is:x = 164

An equation for the total cars and trucks for dealership B is:

y = 2( cars sold by A) + 0.5 (trucks sold by A)

y = 2x + 0.5y = 229

Now, we need to solve the above two equations to find the value of 'x' and 'y'.

Substituting the value of 'x' from the equation for dealership A into the equation for dealership B: y = 2(164) + 0.5y = 328 + 0.5y

Now, subtract 0.5y from both sides:

0.5y = 229 - 3280.5y = -99y = -99/0.5 = -198

Therefore, dealership B did not sell any cars or trucks as the value of 'y' is negative.

However, we can find the number of cars dealership A sold by substituting the value of 'x' into the equation for dealership A: x = 164

Therefore, dealership A sold 164 cars.

You can learn more about the dealership at: brainly.com/question/25666771

#SPJ11

Which of the following does NOT represent a typical way in which firms organize their international activities? A. domestic structure plus export department B. creating an international division organized along functional, product or geographic lines C. domestic structure plus foreign subsidiary D. regional structure

Answers

Option D, regional structure, does not represent a typical way in which firms organize their international activities.

Firms employ various organizational structures to manage their international activities effectively. Option A, domestic structure plus export department, refers to a structure where the firm operates primarily domestically but has a separate department dedicated to managing export activities. Option B, creating an international division organized along functional, product, or geographic lines, involves establishing a separate division within the firm that handles international operations based on different organizational principles. Option C, domestic structure plus foreign subsidiary, indicates a structure where the firm operates domestically but also establishes subsidiaries in foreign markets. These subsidiaries operate independently but are controlled by the parent company.

Option D, regional structure, is not a typical way firms organize their international activities. A regional structure refers to organizing international operations based on geographical regions, such as having separate divisions or units for different regions of the world. While regional structures may be employed in specific cases, they are not as common as the other options mentioned.

Learn more about international activities here:

https://brainly.com/question/31856369

#SPJ11

Money Corp. frequently uses a forward hedge to hedge its Malaysian ringgit (MYR) receivables. For the next month, Money has identified its net exposure to the ringgit as being MYR1,500,000. The 30-day forward rate is $.23. Furthermore, Money's financial center has indicated that the possible values of the Malaysian ringgit at the end of next month are $.20 and $.25, with probabilities of .30 and .70, respectively. Based on this information, the revenue from hedging minus the revenue from not hedging receivables is:

Answers

The revenue from hedging minus the revenue from not hedging receivables can be calculated by considering the net exposure to the Malaysian ringgit, the forward rate, and the probabilities of different exchange rate outcomes.

To calculate the revenue from hedging minus the revenue from not hedging receivables, we need to compare the outcomes of hedging versus not hedging in terms of the exchange rate.

If Money Corp. hedges its receivables, it will lock in the forward rate of $.23 for the net exposure of MYR1,500,000. Therefore, the revenue from hedging will be:

Revenue from Hedging = Net Exposure * Forward Rate = MYR1,500,000 * $.23

To calculate the revenue from not hedging, we consider the probabilities associated with each exchange rate outcome. The expected revenue from not hedging is calculated by multiplying each possible value by its corresponding probability and summing the results:

Expected Revenue from Not Hedging = (Revenue at $.20 * Probability of $.20) + (Revenue at $.25 * Probability of $.25)

Learn more about probability here:

https://brainly.com/question/31828911

#SPJ11

Identify which statements are correct: Multiple select question. liability accounts show the debts of the business assets accounts show the property a business owns owner's equity accounts show the property a business controls

Answers

The correct statements are:-  Liability accounts show the debts of the business, Assets accounts show the property a business owns, and Owner's equity accounts show the property a business controls

Liability accounts show the debts of the business: This means that these accounts track the obligations that the business owes to others, such as loans, bills, and taxes. Examples of liability accounts include accounts payable, notes payable, and accrued expenses.
Assets accounts show the property a business owns: This means that these accounts record the resources that the business has at its disposal, such as cash, inventory, equipment, and land. Examples of asset accounts include cash, accounts receivable inventory property, plant, and equipment.
Owner's equity accounts show the property a business controls: This means that these accounts represent the owner's stake in the business, which is the difference between the assets and liabilities of the business. Owner's equity accounts can include common stock, retained earnings, and additional paid-in capital.

To know more about liability refer to

https://brainly.com/question/14921529

#SPJ11

Other Questions
Grizzly bears, whales, mice, and humans are very different genotypically and phenotypically. However, they do share some genotypic and phenotypic traits because they Noah wants to advertise how many chocolate chips are in each Big Chip cookie at his bakery. He randomly selects a sample of 52 cookies and finds that the number of chocolate chips per cookie in the sample has a mean of 18.5 and a standard deviation of 3.8. What is the 90% confidence interval for the number of chocolate chips per cookie for Big Chip cookies he cash register tape for Swifty Industries reported sales of $27,182.00. Record the journal entry that would be necessary for each of the following situations. (a) Sales per cash register tape exceeds cash on hand by $54.50. (b) Cash on hand exceeds cash reported by cash register tape by $23.50. (List all debit entries before credit entries. Credit account titles are automatically indented when amount is entered. Do not indent manually. Round answers to 2 decimal places, e.g. 52.75.) Which of the following is a possible benefit of the high water content in beer and its diuretic effect?A. It could help prevent the forming of kidney stones.B. It is a psychoactive drug.C. It is a poison. A(n) _______________________ attribute is an attribute with possible values that have a meaningful ranking among them, but the magnitude between successive values is not known. should a restaurant that wants to sell 3000 groupons with a face vale of $75 a $35 each use this tool if groupon charges half of the sales price (keeps half of the $35)? a. yes b. no list three axis powers A man is standing on the shore of a beach, up to his knees in water. Every 5 seconds a wave breaks on him. Calculate the period of the wave. A tennis ball is dropped from 1.0~m1.0 m, bounces off the ground, and rises to 0.85~m0.85 m. What kind of collision occurred between the ball and the ground a fairly common chronic inflammatory disease of the alimentary canal involving all layers of the bowel, which causes chronic diarrhea, is Sales area is a unique combination of _______, _______ and _______. a) sales area, distribution channel, division b) sales organization, plant, division c) sales organization, distribution channel, customer d) sales organization, plant, distribution channel e) sales organization, distribution channel, division Josie is excited to learn that a 5G network is being installed in her area. She recognizes that _____. a. this will increase mobile network latency b. the same antennas already in place for 4G can be reused without modification c. the 5G network will use more energy than the existing 4G network d. this will increase mobile data transfer speeds When is the ap computer science principles create task due 2022. What is the ideal mechanical advantage? if the resistance load is 45.2 n, estimate the effort force required to lift the load. if the effort is applied through a distance of 5 cm, how far will the resistance load move and in which direction? The file sequences.mat contains a set of fictitious bio-sequence in a cell array sequences {mu}(t). Thus sequences {3}(:) is the third sequence, GTCTCCTGCCCTCTCTGAAC which consists of 20 timesteps. There are 20 such sequences in total. Your task is to cluster these sequences into two clusters, assuming that each cluster is modelled by a Markov chain. State which of the sequences belong together by assigning a sequence v^n to that state for which p(hv^n) is highest. You may wish to use mixMarkov. Bill and Donald entered into a bet on the outcome of the next congressional election in their district. After the election, Bill, who bet on the winner, approached Donald, seeking to collect the $3,000 Donald had wagered. Donald paid Bill the wager but now seeks to recover the funds from Bill. Result? When Raul returns home in the late afternoon after three days of hiking and two nights of sleeping in a sleeping bag, he feels exhausted and immediately gets into his bed and sleeps until the next morning. How would the drive-reduction account of motivation explain Raul's behavior Plot diagram for the great gatsby Create a LunchOrder application that prompts the user for the number of hamburgers, salads, french fries, and sodas and then displays the total for the order. The LunchOrder application should include a: Assume that in humans there is a 50/50 chance that a child will be a boy. If a certain mother and father have four sons, what are the chances that their fifth child will be a daughter