What would most likely result if more farms were developed along river basins in North Carolina

Answers

Answer 1

Answer:

Area of river basins, portion in Western North Carolina River Basins Square Miles French Broad 2,830 Yadkin 1,900 Little Tennessee 1,797 Catawba 1,530 6 more rows ...

Explanation:

hopes this helps D:

Answer 2

Answer:

the answer is an increase in water pollution


Related Questions

the chief purpose of the photosynthetic process is considered to be the​

Answers

The answer is Water cycle because that is what photosynthesis is

Are enzymes needed for metabolism?
A. YES!
B. NO!
C. MAYBE SO!

D. ALL OF THE ABOVE (This option clearly makes no sense! Don't pick it!)​

Answers

A.

Enzymes break down food

Answer:

YES! (Don't mean to yell, but those were the options.)

Explanation:

Enzymes break down food, and therefore, are needed for metabolism.

Which function of the integumentary system is illustrated in the release of sweat?
Absorbtion
Protection
Sensory Reception
Regulation
Secretion
Both regulation and secretion

Answers

Answer:

Secretion

Explanation:

Not completely sure tho, good luck

Meaning of all of these words below (Will be appreciated! I really need help! 30points!!! ^^):
autotroph, heterotroph, producer, consumer, herbivore, carnivore, omnivore, scavenger, ecosystem, population, community, terrestrial ecosystem, marine ecosystem, aquatic ecosystem, biotic factor, abiotic factor, predator, prey, predation, competition, carrying capacity, limiting factor, decomposer

Answers

Autotroph -
makes own food using natural objects

Heterotroph - gets food from animals

Producer - makes own food

Consumer - eats other animals

Herbivore - only eats plants

Carnivore - only eats meat/animals

Omnivore - diet of plants and meat/animals

Scavenger - feeds on dead organisms

Ecosystem - environment where organisms interact

Population - group of individuals of the same species living together

Community - interacting group of various species in a common location


Autotroph: organism that is able to form a neutral organic substances heterotroph: an animal that can't make its own food supply producer: a person, company, or country that makes, grows and supplies goods consumer: a person or thing that eats or uses something herbivor: animal that eats off of plants carnivore: animal that eats meat or skin omnivore: animal that eats both plants and meat scavenger: a person who looks for missing items ecosystem: where organisms call home population: the number of people/living things in one area community: a group of people living around the same place terrestrial ecosystem: group of living organisms living on a land-based area marine ecosystem: under the sea where the salt levels are really high aquatic ecosystem: ecosystem of a body of water biotic factor: a non living part of an ecosystem that shapes an environment abiotic factor: non living physical and chemical elements in the ecosystem predator: an animal hunting for another animal to eat prey: the animal victim of a predator predation: the preying of one animal on others competition: an event or contest that people compete in carrying capacity: a species' average population size limiting factor : anything that is a population size decomposer: an organism that breaks down chemical

.

.

.

phew that was a lot. I hope you have a great day!!

A student examines a periodic table.
Which inferences about sodium (Na) are true?

Answers

Answer:

true c this is the answer

A child has a mass of 30 Kg on earth. If the gravity on the Moon is one sixth that of the earth what is the mass of the child moon

Answers

Answer:

30 kilograms

Explanation:

A change in gravity does not affect mass.

Multiple Choice
A student observed bees flying between flowers on a squash vine. after researching this activity, the student learns that bees obtain nectar from the flowers. The pollen from the flowers sticks to the bees and is transported to another flower of the same species, resulting in pollination. The student decides this is an example of mutualism. Which table explains why this relationship is mutualism?

Answers

Answer:

The answer is D

Explanation:

Flowers and bees both benefit from pollination so D

Answer: that should be d

Explanation:

CTT GAC TGA TGC

3. Transcribe the DNA Strand (answer to previous question) to an mRNA strand:
(2 point)

Answers

Answer:

GAA CTG ACG

Explanation:

this will be the complementary DNA strand.

A=T

G=C

C=G

and above you will see the answer key for any DNA strand complementary.

transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-

Answers

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

A student used a microscope to study four members of the phylum Ciliophora. Members of
this phylum move when propelled by hundreds of tiny cilia.
Paramecium
caudatum
Paramecium
aurelia
Os
ALLA
3220
Paramecium
bursaria
Paramecium
multimicronucleatum
VIITTEITA
Although these organisms belong to the same phylum, they are classified as different -
A families
B species
C kingdoms
D orders

Answers

Answer:

A

Explanation:

Makes the most sense

Although these organisms belong to the same phylum, they are classified as different families. Thus, option A is correct.

What is family?

The family structure that is being described in the description above is step family structure. The step family is being formed by which one family ends with divorce and the individual is likely to get remarried, creating a blended or step family that is associated with two families that are separated.

Family of choice refers to the concept of family is intended to capture the commitment of chosen, not fixed, care and support. A family of choice is also known as chosen family and found family. It is a family that is made up of intentionally by chosing the members for love and support rather than blood. Basically, family of choice is that one in which people chose their member intentionally.

Therefore, Although these organisms belong to the same phylum, they are classified as different families. Thus, option A is correct.

Learn more about families on:

https://brainly.com/question/2284676

#SPJ6


One Multiple Choice (A, B, or C) question and one True/False question.
For probability and permutations and combinations

Answers

what’s the questions ?

disadvantages of pedigree analysis

Answers

It tend to be relatively large because of the coarse nature of the meiotic process
disadvantage of pedigree designs is that genomic regions identified via linkage analysis tend to be relatively large because of the coarse nature of the meiotic process (Boehnke 1994).

What happens to chromosomes when an ovum and a sperm meet at fertilisation

Answers

Answer: When egg and sperm cells combine in fertilizations, they merge the two sets of chromosomes, ending up with 46 chromosomes in total. The maternal chromosomes from the egg cell and the paternal chromosomes from the sperm cell pair up. The resultant cell is called a zygote. Fertilization happens when a sperm cell successfully meets an egg cell in the fallopian tube. Once fertilization takes place, this newly fertilized cell is called a zygote. From here, the zygote will move down the fallopian tube and into the uterus. The zygote then burrows into the uterus lining.

Explanation:

What type of volcano is pictured below?
composite volcano
shield volcano
strato-volcano
cinder volcano

Answers

Hey!! The answer is shield volcano.

A shield volcano has a low profile, like the one in the picture.

Can I please have Brainliest? hope this helps!! :)

Answer:

the answer is the shield volcona

A plant produces seed cones and pollen cones . Is it vascular? To what group of plants does it belong

Answers

A plant produces seed cones and pollen cones. Belong to plant group
phylum Coniferophyta and Yes it is vascular

A plant that produces seed cones and pollen cones is a vascular plant, and plants that produce seed cones and pollen cones belong to the group of plants known as gymnosperms.

What are gymnosperms?

Gymnosperms are a group of seed plants that produce seeds that are not enclosed in an ovary and produce open seeds that are usually borne in cones and include a variety of plant species, including conifers such as pine, spruce, and fir trees, cycads such as palm-like plants, ginkgoes, etc., and the production of seed cones and pollen cones is a vital characteristic of gymnosperms, these seed cones, which are also called female cones, produce seeds that are typically larger and more complex than pollen grains.

Hence, a plant that produces seed cones and pollen cones is a vascular plant and belongs to the group of plants known as gymnosperms.

Find out more about gymnosperms here.

https://brainly.com/question/15158870

#SPJ2

List 4 viruses and the diseases they cause (1 disease per virus) please help!!!!​

Answers

smallpox, herpes, rabies, and the common cold :)

Why do we not use a Punnett Square to determine the offspring for asexual reproduction? Is that form of reproduction diverse? Explain your answer.

Answers

Answer: There isn’t another organism to cross with

Explanation:

In asexual reproduction there is only one parent so all the genes come from one person.

Which best describes the end result of meiosis?
O A. two diploid cells identical to the parent cell
o B. four haploid cells identical to the parent cell
C. two diploid cells different from the parent cell
D. four haploid cells different from the parent cell

Answers

D Four haploid cells different from the parent cell

White blood cells ingest, then digest, a number of bacteria and other pathogens. White blood cells would require high numbers of which organelle in order to function properly?

Answers

Answer:

Lysosome

Explanation:

Stem cells in plants are referred to as?
1. merimex
2. meristems
3. stalk stem cells
4. special stem cells

Answers

The answer is B




Hope this helps

Which of the following is an advantage of meiosis and sexual reproduction?
A. Meiosis ensures that offspring will not inherit any genetic disorders.
B. Meiosis ensures that offspring are genetically identical as their parents.
C. Meiosis ensures that offspring will have identical phenotypes to their parents.
D. Meiosis ensures a wider variety of genetic variation.

Answers

Answer:

D. Meiosis ensures a wider variety of genetic variation.

This happens above all thanks to the Crossing over, the process in which the exchange of genetic material during sexual reproduction between two homologous chromosomes' non-sister chromatids results in recombinant chromosomes.

The white blood cells in the lungs release protease. Suggest the function of this enzyme in the white blood cells in the lungs.
( Pls don't answer for points. Serious answers only )

Answers

Answer: Protease is an enzyme which causes break down of proteins by converting them into smaller polypeptides or amino acids.

Explanation:

Proteases are the enzymes that are necessary for the functioning of the lungs. They cause the regeneration and repair of white blood cells as protease can digest connective tissue elements. They are responsible for generating an inflammation response during infection caused by a pathogen. Thus prevents lung infection.  Inhibition of the anti-proteolytic mechanism is essential for the controlling microbial infection and lung inflammation.

What is the meaning of the term metabolism?

Answers

Metabolism is the chemical processes that occur within a living organism in order to maintain life. Have a good day! Also, any answer that says, ‘Here is the link to your answer: (link)’ DO NOT CLICK ON IT!!

Make a key out of this picture, in other words differentiate between each. ​

Answers

Answer:

They are different due to their colour, number of petals, and shape of petals.

Explanation:

These flowers are different from one another because of their colour, number of petals, and shape of petals. Some flowers are pink in colour, some are white and others are yellow in colour. Some has five petals whereas some has four petals. Some petals of flowers has circular shape, some petals has pointed shape, while others are 'W' shape.

Archie Carr helped save turtles from extinction. What did he do during Operation Green Turtle?
A.) He made laws against hunting turtles.
B.) He took turtle eggs to safe beaches.
C.) He cleaned the turtles after an oil spill.
D.) He planted grasses that turtles eat.

Answers

Answer:B

Explanation:The project distributed green turtle eggs and hatchlings to various nesting beaches around the Caribbean and the Gulf of Mexico in an effort to encourage the growth of their dwindling populations. His conservation efforts also led him to lead campaigns against ocean pollution.

What are the two most common sources for rivers and streams?

Answers

Answer:The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:I did this in class 2 days ago LOL

Answer:

The source of a river or stream may be a lake, a marsh, a spring, glacier, or a collection of headwaters. The furthest stream is called the headstream. Headwaters are small streams that create the river or stream and may be cool waters, because of shade and barely melted ice or rain.

Explanation:

Hope this helped you :D

2. Write the complementary DNA strand: (1 points)
CTT GAC TGA TGC

Answers

GAA CTG ACT ACG is the answer
GAA CTG ACT ACG
pretty sure this is right

Which of the following planets has the largest elliptical orbit?
A. Jupiter
B. Uranus
C. Saturn
D. Earth​

Answers

It will be B. Uranus

Correct me if I’m wrong

what happens to most solar radiation when it gets to earth??

Answers

Answer:

Most of the solar radiation is bounced off of earth´s atmosphere.

Explanation:

Due to earth´s magnetic field, we are able to be protected from most of the solar radiation the sun emits.

Why do siblings always look different from each other even though they have the same parents? *

A. Siblings look exactly the same.
B. This is because there are always random mutations in everyone's DNA.
C. There is no reason, this is just random.
D. Due to meiosis, siblings each get slightly different genetic information from both parents.
which one ^

Answers

it’s d
each sibling gets different genetic information

Answer:

Siblings look different cause of the genetics combining through child creation

Explanation:

Other Questions
At a picnic, there is a 5-gallon drinkdispenser filled with juice. Juice is servedin cups that each hold 8 fluid Ounces whenthey are full. What is the greatest numberof cups that can be served? El 10% de que numero es 32 Riverton Corp., which began business at the start of the current year, had the following data: Planned and actual production: 40,000 units Sales: 37,000 units at $15 per unit Production costs: Variable: $4 per unit Fixed: $260,000 Selling and administrative costs: Variable: $1 per unit Fixed: $32,000 The contribution margin that the company would disclose on a variable-costing income statement is:________. a. None of the answers is correct. b. $166,500. c. $97,500. d. $370,000. e. $147,000. Can someone please help me? I'm stuck. P.S. correct answer will get brainliest. The square has a side length of 10 ft and the circle inside the square has a diameter of 10 ft find the approximate area of the shaded region use 3.14 as an estimation for During the Baroque period, the soprano and bass voices were more important in a choral composition than the tenor and the alto. true or false? Show all work to solve this problem. The budget for a new kitchen includes $3,000 for new kitchen equipment. The chef spent $90 of that money for new aprons. What percent of the money for new kitchen equipment was spent on aprons? Someone help please I cant seem to get this one and its my last one help me someone with my man problem Select the three expressions that are equivalent to -2(4 - 3x) + (5x - 2).A. 2x - 10B. 11x - 10C.-8 + 11x - 2D. -8 - 11x - 2E. -8 + 6x + 5x - 2F. -8 - 3x + 5x - 2What mathematical process did you use tosimplifying the expression above? You are stumped on an important math test and you have the perfect opportunity to cheat without getting caught. What do you do, and how do you explain your decision?give me 3-5 sentences HELP! WILL GIVE BRAINLIEST I NEED HELP ASAP I need help figuring out the answer. please help The diameter of a cone is 4 centimeters and has a height of 6 centimeters. How muchgreater is the volume of a cylinder that has the same diameter and same height? Jamie wants to treat some friends to lunch. He has $40 and knows the lunch will cost about $7 per person p. How many people can Jamie buy lunch for. please help me lol How many grams of magnesium sulfate (MgSO4) are dissolved in 0.965 L of a 0.0575 M solution? Molar Mass Mg: 24.30 g/mol Molar Mass S: 32.06 g/mol Molar Mass O: 16.00 g/mol The sum of the measures of the angles of the triangle is 180 degrees. What is the value of each angle in the triangle if angle one is (3x + 51), angle two is (x) and angle three is (x + 19) I'm gonna send you a picture of it The security code to your home security system includes three single digit numbers 2.and two letters. Repetition is allowed for the numbers but not allowed for the letters. Please help!!! I need it badly!In "The New Colossus," we discovered that the author used an allusion. In this allusion she references another statue that existed long ago. How is the statue from the allusion different from the statue being described in the poem? Be sure to use evidence from the poem the states how each statue is different from the other. For this response you need to use the RACE writing strategy. R- Restate the QuestionA- Answer the questionC- Cite evidence from the text. You MUST use an exact quote from the poem to support your answer.E- Explain the evidence - In this sentence, be sure that you are showing how the two statues are opposite from one another.Con - Give a conclusion. The New ColossusNot like the brazen giant of Greek fame,With conquering limbs astride from land to land;Here at our sea-washed, sunset gates shall standA mighty woman with a torch, whose flames the imprisoned lightning, and her nameMother of Exiles. From her beacon-handGlows world-wide welcome; her mild eyes commandThe air-bridged harbor that twin cities frame.Keep, ancient lands, your storied pomp! cries sheWith silent lips. Give me your tired, your poor,Your huddled masses yearning to breathe free,The wretched refuse of your teeming shore.Send these, the homeless, tempest-tost to me,I lift my lamp beside the golden door! brazen bold; also, literally made of brasspomp showy displays meant to be impressiverefuse things to be discarded; things considered to have no valueteeming full tempest a violent storm