Answer:
Which statement provides the best description of the interphase portion of the cell cycle? Interphase is a resting stage prior to cell division. During interphase, a cell is metabolically active.
S
11. Evaluate how a person's blood calcium levels
would be affected if his or her thyroid gland
stopped working.
our thyroid glands plays a main role in a human body. It secretes thyroxine and calcitonin. In which thyroxine help in growth and cellular metabolism and calcitonin helps to regulates calcium concentration in blood . If thyroid gland stops working then there is low level of calcium in our blood, which leads to mental and hormonal disorder. In this way a person's blood calcium level would be affected if his/her thyroid gland stops working.
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
What do you mean by Transcription?Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).
Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.
Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
To learn more about Transcription, refer to the link:
https://brainly.com/question/1048150
#SPJ4
How is ocean acidification important to the world?
Answer:
Ocean acidification is already impacting many ocean species, especially organisms like oysters and corals that make hard shells and skeletons by combining calcium and carbonate from seawater.
descirbe the weather conditions associated with warm and cold fronts. why do these conditions differ
Answer:
A cold air front is where a cold air mass replaces warm air. The different air masses do not mix because of different densities.
Explanation:
When pigs reproduce, which two types of cells pass on information from the pigs to the piglets?
Answer:
nuclei
Explanation:
Nuclei male and nuclei female to create a zygote
The two type of cells that pass on information from the pigs to the piglet is the male and female reproductive cells.
What is male and female reproductive cell?The male and female reproductive cell contains information about the parents that are passed on to the offspring.
The piglet inherit some genes from both parents through their cells.
Therefore, The two type of cells that pass on information from the pigs to the piglet is the male and female reproductive cells.
Learn more on reproductive cell,
https://brainly.com/question/1601480
#SPJ6
How does a comparison of bone structures of two animal provide evidence of an evolutionary relationship
Answer: Comparative Anatomy
Both provide evidence for evolution. Homologous structures are structures that are similar in related organisms because they were inherited from a common ancestor. These structures may or may not have the same function in the descendants.
Explanation: hope it helps
mark me as brainliest ^_^
Over the course of evolution, the bones of the animals undergo a gradual change in shape as well as in size. But still, two closely related animals have an identical overall layout of the bone.
What do you mean by Evolution?Evolution may be defined as a gradual process that involves changes or modifications in the members of the same or different species over a long period of time.
The bones of descent common ancestors reveal the evolutionary relationships among the animals. In relationship involves homologous and analogous structures.
The homologous structure reveals the structural similarity between the animals, while the analogous structures reveal the functional similarity.
Therefore, it is well described above.
To learn more about Evolutionary relationships, refer to the link:
https://brainly.com/question/26125007
#SPJ2
What happens to the lac operon when both glucose and lactose are present?
Answer:
If both glucose and lactose are both present, lactose binds to the repressor and prevents it from binding to the operator region. The block of lac gene transcription is thus lifted, and a small amount of mRNA is produced.
Explanation:
how is dna copied in your own words?
Answer:
Replication is the process by which a double-stranded DNA molecule is copied to produce two identical DNA molecules. DNA replication is one of the most basic processes that occurs within a cell. Each time a cell divides, the two resulting daughter cells must contain exactly the same genetic information, or DNA, as the parent cell. To accomplish this, each strand of existing DNA acts as a template for replication.
Replication occurs in three major steps: the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment. During separation, the two strands of the DNA double helix uncoil at a specific location called the origin. Several enzymes and proteins then work together to prepare, or prime, the strands for duplication. Finally, a special enzyme called DNA polymerase organizes the assembly of the new DNA strands. The following description of this three-stage process applies generally to all cells, but specific variations within the process may occur depending on organism and cell type.
Answer:
website answer... the opening of the double helix and separation of the DNA strands, the priming of the template strand, and the assembly of the new DNA segment.
Explanation:
in my own words... the double helix and the separation of dna strands and the priming temlete strand and the assembly of a brand new dna segment
HELP ME!!!!! What is an important part of scientific methods? there is more then one answer so Select all correct answers.
A. establishing state of the art labs
B. forming conclusions
C. making hypothesis
D. using computers
Answer:
B and C
Explanation:
establishing state of the art labs isn't a part of the scientific method and neither is using computers
Which group contains only innate physical defenses?.
Answer:inflammatory response, phagocytosis, natural killer cells, and the complement system.
Explanation:
Let's review how photosynthesis works by looking at the
origin of the output molecules. Please identify which
statements are accurate.
Oxygen is consumed during the process of photosynthesis
An aquatic photosynthetic organism will produce oxygen
bubbles as it carries out photosynthesis
Only plants generate oxygen as a byproduct of photosynthesis
Glucose is consumed during the process of photosynthesis
Photosynthesis is a process that produces sugar
Answer:
Photosynthesis is a process by which green plants turn carbon dioxide and water into food using energy from sunlight.
What do statements are true about a punt square
Answer:
Punnett squares predict the probability of different genotypes in offspring
Hope it helps
TC
have a great Time
A type of ribonucleic acid that Incodes genetic information
Answer:
Explanation:
Cellular organisms use messenger RNA (mRNA) to convey genetic information (using the nitrogenous bases of guanine, uracil, adenine, and cytosine, denoted by the letters G, U, A, and C) that directs synthesis of specific proteins. Many viruses encode their genetic information using an RNA genome.
Describe two ways that the carbohydrates are used in the ecosystem.
Answer:Organisms use carbohydrates produced by photosynthesis by oxidizing them to produce energy for respiration
Explanation:Organisms use carbohydrates produced by photosynthesis by oxidizing them to produce energy for respiration. – The glucose produced in green plants is directly utilized for respiration and other activities, while the excess is stored in the form of starch.
Plants are able to engage in photosynthesis because they produce a chemical that can absorb sunlight to synthesize glucose. What is this chemical?.
Answer:
Chlorophyll
Explanation:
Plants engage in photosynthesis with the help of chlorophyll.
In the process : Carbon dioxide is used and oxigen is produced.
What organism meets the criteria for group b? question 3 options: hammerhead shark emperor penguin rattle snake box turtle
Emperor penguin meets the criteria for Group B.
The Emperor penguin is an organism that meets the criteria for group b.
Are penguins Endotherm or Ectotherm?Endotherms: Penguins, and prairie dogs, like most other birds and mammals, are endotherms. Iguanas and rattlesnakes, like most other reptiles along with most fishes, amphibians, and invertebrates are ectotherms.
Endotherms generate most of the heat they need internally.
Thus, the emperor penguin is an organism that meets the criteria for group b.
To learn more about penguins click here:
https://brainly.com/question/311514
Which statement presents a credible and unbiased argument for selecting a particular livestock animal as a human organ donor?
(Please help, this is a practice question btw)
A. A calf is the best candidate, because a cow's gestation period most closely matches a human's (9 months/280 days), and that feels most natural.
B. A lamb is the best candidate, because sheep are less likely to be sold as a meat source and because lambs are inherently cute.
C. A piglet is the best candidate. A pig's gestation period is the briefest, so human hearts could be more quickly grown and transplanted.
D. Livestock candidates should be chosen based on the patient's preference, otherwise there could be organ rejection.
Livestock candidates should be chosen based on the patient's preference as there could be organ rejection is an unbiased argument.
What is an Unbiased argument?This type of argument shows the reader both sides and bids the reader decide.
The other options tends to support an animal which makes them biased but option D doesn't and has a credible reason which is why it's the most appropriate choice.
Read more about Unbiased argument here https://brainly.com/question/2399804
What prevents the blood in veins from flowing in the wrong direction?.
Answer:
The heart valves
Explanation:
The heart valves prevent blood from flowing in the wrong direction in the heart. The valves are held in the proper place because of the chordae tendinae.
Answer this pls!!!!!!!
What do enzymes do?
Answer:
Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They build some substances and break others down.
Explanation:
can the shape of globin change ?
Answer:
People with the sickle cell mutation in both copies of the HBB gene produce proteins that clump together and lead to changes in the shape and behavior of red blood cells.
Adipose tissue is one of the most hydrated of all tissues in the human body
Answer:
False
Explanation:
Adipose tissue is one of the lease hydratetd of all tissues in the human body.
Adipose tissue is one of the most hydrated of all tissues in the human body and is one of the maximum hydrated of all tissues withinside the human frame.
What is intracellular fluid?The maximum ample cation in intracellular fluid is sodium. Solutes, irrespective of size, are capable of pass freely among booths due to the fact water includes them alongside the osmotic gradients.
Adipose tissue carries approximately 10% of water, even as muscle groups carries approximately 75%. In Netter's Atlas of Human Physiology, frame water is damaged down into the subsequent booths: Intracellular fluid (2/three of frame water) is fluid contained inside cells.
To read more about the Adipose tissue refer link :
https://brainly.com/question/546428
#SPJ4
What does it mean to say that an organism is well adapted to its environment?.
researcher investigates a recently discovered species of plant. The plant has vascular tissues and exhibits a sporophyte and a gametophyte generation, but lacks seeds. How should the researcher classify the plant?
pteridophyte
Explanation:As you might guess, Pteridophyte are plants that can move through the air. They do not make new plants by releasing seeds.
Other pteridophyte characteristics include the following:
They exhibit alternation of generations, in which the sporophyte and gametophyte generations are observed.Sporophytes are plants with true roots, stems, and leaves.Sporangia grow in clusters on sporophylls.I hope this helps you
:)
R 16 (050SMC)
Primary production isted in much of the open ocean by low levels of won, which is a necessary phytoplankton rent it has been suggested by some that pumps could be placed in these
phytoplankton blooms. What problem uma mpact) do you think scientists would be trying to address with this biotechnological approach?) ponto)
would move on her from the deep to the
whole thing
O Reduction in Iron pollution in ocean sediments
O Reduction of bycatch
Reduction of the greenhouse gas carbon dioxide in the atmosphere
Reduction of the human impact on marine species diversity
Answer: Reduction of the greenhouse gas carbon dioxide in the atmosphere
Explanation:
phytoplankton use photosynthesis to take the sun’s light waves and convert it into energy. They also take carbon dioxide and convert it into oxygen for other organisms to breathe.
Florida experiences a lot of rain in the summer months. How do plants respond to this?
Answer:
They Start to Sprout and bud
Answer:
They grow more and produce flowers or fruit.
Explanation:
I got it right on my quiz haha
Hope this helped/helps!!
Have a nice day alsooo!
Can someone please help me? :( I’ll give brainliest!!
Answer:
I Think it is B
but i can really see what D is saying
Combine these amino acids into a tripeptide. Add or remove atoms and bonds as needed
Tripeptides such as Glycine-Alanine-Serine consists of three amino acids linked together by peptide bonds.
What are amino acids?Amino acids are the monomer units fro which proteins are made. Amino acids consists of a central carbon atom with
an amino group,a carboxyl group, a hydrogen atom anda side chain group all bonded to the central carbon atom.Peptides are formed when two or more amino acids are joined together by means of a peptide bond.
A tripeptide is a peptide consisting of three amino acids linked. An example of a tripeptide is: Glycine-Alanine-Serine.
Therefore, a tripeptide such as Glycine-Alanine-Serine consists of three amino acids.
Learn more about peptides at: https://brainly.com/question/24326041
A Tripeptide may be defined as a peptide consisting of three amino acids joined together by peptide bonds. Glutathione is a common tripeptide that consists of Glutamine-Cysteine-Glycine.
What do you mean by Amino acids?Amino acids may be defined as the building blocks of proteins which are consist of both a carboxyl (—COOH) and an amino (—NH2) group.
In Glutathione, three amino acids are joined together by a peptide bond to form a tripeptide. During the joining of two amino acids, a molecule of water is released.
Therefore, it is well described above.
To learn more about Peptides, refer to the link:
https://brainly.com/question/17089864
#SPJ4
how are organisms separated
Answer:
prezgotic and postzygotic barriers
Explanation:
according to the biological species concept, organisms belong to the same species if they can interbreed to produce viable, fertile offspring. Species are separated from one another by PREZGOTIC AND POSTZGOTIC BARRIERS, which prevent mating or the production of biable, fertile offspring.Answer:
Organisms separate using a cellular process that replicates chromosomes and produces two identical nuclei in preparation for cell division. Generally, mitosis is immediately followed by the equal division of the cell nuclei and other cell contents into two daughter cells.
If round seeds is dominant to wrinkled seeds in peas, what type of stem will the offspring of a round seed plant and a wrinkled seed plant have
Since the round seed gene is the dominant gene, it follows that, a cross between a round seed plant and a wrinkled seed plant will lead to only round seed offspring.
What is genetics?Genetics is the science that studies the patterns of inheritance. The unit of inheritance located in the chromosome is called the gene.
Since the gene for having round seeds is dominant over the gene for having wrinkeled seeds, a cross between a round seed plant and a wrinkled seed plant will lead to only round seed offspring.
Learn more about genetics:https://brainly.com/question/12985618
Both plant and animal cells as well as many unicellular organisms contain
Answer:
Both plant and animal cells as well as many unicellular organisms, contain a mitochondria and nucleus which supply energy for a cell .
Explanation:
Cell is the basic functional and structural unit of life. Plant, animal as well as many unicellular organisms contain cell organelles and mitochondria which supply energy to cells.
What are different cell organelles?Cell organelles are the structures inside a cell that floats inside the cytoplasm.
Any cell that is living has cell organelles.
Cell organelles are as follows:
Mitochondria: form ATP and provides energy to the cell.Nucleus: Brain of the cell.Ribosome: helps in protein synthesis.Endoplasmic reticulum: It helps in the transport of substances.Golgi bodies: involves in packaging.Lysosome: involved in digestion of cell.Thus, Both plant and animal cells as well as many unicellular organisms contain organelles and mitochondria that provides energy to the cell.
For more details regarding cell organelles, visit:
https://brainly.com/question/2787889
#SPJ3