Answer:
The answer is Carbohydrates.
Explanation:
They are one of the most important nutrient.
-Justin:)
HEEEELLLLPPPPP
Deforestation is the second leading cause of global warming (climate change) worldwide, and it produces about 24% of global greenhouse gas emissions. Deforestation in the tropical rainforests contributes more carbon dioxide to the atmosphere than the sum of all cars and trucks that drive on the world’s roads.
Why would deforestation this lead to more carbon dioxide?
a
The changed habitats support more animals, like native birds and mammals, that produce more carbon dioxide.
b
The increased amount of timber harvested produces oxygen gas, which encourages the wildlife to generate carbon dioxide.
c
Loss of trees leads to a decrease of the ability of forests to act as carbon sinks to remove carbon dioxide from the atmosphere.
d
Equipment used for clear-cutting produce metric tons of carbon dioxide, which is released into the atmosphere during the process of deforestation
Answer:
C
Explanation:
According to Worldwildlife.org, Forest play a critical role in mitigating climate change because they act as a carbon sink - soaking up carbon dioxide that otherwise be free in the atmosphere and contribute to ongoing changes in climate patterns.
how are organisms separated
Answer:
prezgotic and postzygotic barriers
Explanation:
according to the biological species concept, organisms belong to the same species if they can interbreed to produce viable, fertile offspring. Species are separated from one another by PREZGOTIC AND POSTZGOTIC BARRIERS, which prevent mating or the production of biable, fertile offspring.Answer:
Organisms separate using a cellular process that replicates chromosomes and produces two identical nuclei in preparation for cell division. Generally, mitosis is immediately followed by the equal division of the cell nuclei and other cell contents into two daughter cells.
researcher investigates a recently discovered species of plant. The plant has vascular tissues and exhibits a sporophyte and a gametophyte generation, but lacks seeds. How should the researcher classify the plant?
pteridophyte
Explanation:As you might guess, Pteridophyte are plants that can move through the air. They do not make new plants by releasing seeds.
Other pteridophyte characteristics include the following:
They exhibit alternation of generations, in which the sporophyte and gametophyte generations are observed.Sporophytes are plants with true roots, stems, and leaves.Sporangia grow in clusters on sporophylls.I hope this helps you
:)
Movement of phloem sap from a source to a sink ________.
Bulk flow refers to the movement of phloem sap from a source to a sink in plants.
What is Phloem?This is a vascular tissue found in plants which helps to transport and distribution of the organic nutrients derived from photosynthesis.
Bulk flow occur when these nutrients present in the phloem sap are moved from source to sink.
Read more about Phloem here https://brainly.com/question/983997
Combine these amino acids into a tripeptide. Add or remove atoms and bonds as needed
Tripeptides such as Glycine-Alanine-Serine consists of three amino acids linked together by peptide bonds.
What are amino acids?Amino acids are the monomer units fro which proteins are made. Amino acids consists of a central carbon atom with
an amino group,a carboxyl group, a hydrogen atom anda side chain group all bonded to the central carbon atom.Peptides are formed when two or more amino acids are joined together by means of a peptide bond.
A tripeptide is a peptide consisting of three amino acids linked. An example of a tripeptide is: Glycine-Alanine-Serine.
Therefore, a tripeptide such as Glycine-Alanine-Serine consists of three amino acids.
Learn more about peptides at: https://brainly.com/question/24326041
A Tripeptide may be defined as a peptide consisting of three amino acids joined together by peptide bonds. Glutathione is a common tripeptide that consists of Glutamine-Cysteine-Glycine.
What do you mean by Amino acids?Amino acids may be defined as the building blocks of proteins which are consist of both a carboxyl (—COOH) and an amino (—NH2) group.
In Glutathione, three amino acids are joined together by a peptide bond to form a tripeptide. During the joining of two amino acids, a molecule of water is released.
Therefore, it is well described above.
To learn more about Peptides, refer to the link:
https://brainly.com/question/17089864
#SPJ4
How and why do organisms interact with one another?
Answer:
It's in their makeup to interact
Explanation
They need to interact to survive, to exist, to reproduce!
Answer:Organisms interact because of mating, competition for food resources, defense, and assertion of dominance.
Explanation:
Which mrna sequences would form a structure that is a cue for transcription termination of some genes?
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
What do you mean by Transcription?Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).
Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.
Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.
To learn more about Transcription, refer to the link:
https://brainly.com/question/1048150
#SPJ4
Plants are able to engage in photosynthesis because they produce a chemical that can absorb sunlight to synthesize glucose. What is this chemical?.
Answer:
Chlorophyll
Explanation:
Plants engage in photosynthesis with the help of chlorophyll.
In the process : Carbon dioxide is used and oxigen is produced.
What does it mean to say that an organism is well adapted to its environment?.
The picture shows us how the Sun's rays strike Earth. Because of the Earth's tilt on its axis, some parts of Earth are having summer
and others, winter. What letter or letters on the Earth are experiencing summer?
A) B
B) C
C) B and C
D) C and D
Answer:
B n C
Explanation: You can tell this because when you look at the diagram it shows B and C facing the sun so that means it's summer.
Answer
D.) C and D
Explanation:
It may look like B and C, but the sun hardly reaches up in the north, plus its axis is shifted so it's not technically summer for them yet, this leaves the bottom, which will rotate and give both sides the taste of summer glory.
Once the earth rotates more, it will be summer for B. and A.
But the graph shows that the answer is
D.) C and D
What happens to the lac operon when both glucose and lactose are present?
Answer:
If both glucose and lactose are both present, lactose binds to the repressor and prevents it from binding to the operator region. The block of lac gene transcription is thus lifted, and a small amount of mRNA is produced.
Explanation:
Which statement presents a credible and unbiased argument for selecting a particular livestock animal as a human organ donor?
(Please help, this is a practice question btw)
A. A calf is the best candidate, because a cow's gestation period most closely matches a human's (9 months/280 days), and that feels most natural.
B. A lamb is the best candidate, because sheep are less likely to be sold as a meat source and because lambs are inherently cute.
C. A piglet is the best candidate. A pig's gestation period is the briefest, so human hearts could be more quickly grown and transplanted.
D. Livestock candidates should be chosen based on the patient's preference, otherwise there could be organ rejection.
Livestock candidates should be chosen based on the patient's preference as there could be organ rejection is an unbiased argument.
What is an Unbiased argument?This type of argument shows the reader both sides and bids the reader decide.
The other options tends to support an animal which makes them biased but option D doesn't and has a credible reason which is why it's the most appropriate choice.
Read more about Unbiased argument here https://brainly.com/question/2399804
Both plant and animal cells as well as many unicellular organisms contain
Answer:
Both plant and animal cells as well as many unicellular organisms, contain a mitochondria and nucleus which supply energy for a cell .
Explanation:
Cell is the basic functional and structural unit of life. Plant, animal as well as many unicellular organisms contain cell organelles and mitochondria which supply energy to cells.
What are different cell organelles?Cell organelles are the structures inside a cell that floats inside the cytoplasm.
Any cell that is living has cell organelles.
Cell organelles are as follows:
Mitochondria: form ATP and provides energy to the cell.Nucleus: Brain of the cell.Ribosome: helps in protein synthesis.Endoplasmic reticulum: It helps in the transport of substances.Golgi bodies: involves in packaging.Lysosome: involved in digestion of cell.Thus, Both plant and animal cells as well as many unicellular organisms contain organelles and mitochondria that provides energy to the cell.
For more details regarding cell organelles, visit:
https://brainly.com/question/2787889
#SPJ3
Answer this pls!!!!!!!
What do enzymes do?
Answer:
Enzymes are proteins that help speed up metabolism, or the chemical reactions in our bodies. They build some substances and break others down.
Explanation:
What is the shape of DNA when it is not undergoing replication?
Explanation:
If DNA replication does not occur, then the cell cycle will not proceed to the next stage and the subsequent division will not happen. It will lead to cell death.
What organism meets the criteria for group b? question 3 options: hammerhead shark emperor penguin rattle snake box turtle
Emperor penguin meets the criteria for Group B.
The Emperor penguin is an organism that meets the criteria for group b.
Are penguins Endotherm or Ectotherm?Endotherms: Penguins, and prairie dogs, like most other birds and mammals, are endotherms. Iguanas and rattlesnakes, like most other reptiles along with most fishes, amphibians, and invertebrates are ectotherms.
Endotherms generate most of the heat they need internally.
Thus, the emperor penguin is an organism that meets the criteria for group b.
To learn more about penguins click here:
https://brainly.com/question/311514
HELP ME!!!!! What is an important part of scientific methods? there is more then one answer so Select all correct answers.
A. establishing state of the art labs
B. forming conclusions
C. making hypothesis
D. using computers
Answer:
B and C
Explanation:
establishing state of the art labs isn't a part of the scientific method and neither is using computers
Let's review how photosynthesis works by looking at the
origin of the output molecules. Please identify which
statements are accurate.
Oxygen is consumed during the process of photosynthesis
An aquatic photosynthetic organism will produce oxygen
bubbles as it carries out photosynthesis
Only plants generate oxygen as a byproduct of photosynthesis
Glucose is consumed during the process of photosynthesis
Photosynthesis is a process that produces sugar
Answer:
Photosynthesis is a process by which green plants turn carbon dioxide and water into food using energy from sunlight.
Adipose tissue is one of the most hydrated of all tissues in the human body
Answer:
False
Explanation:
Adipose tissue is one of the lease hydratetd of all tissues in the human body.
Adipose tissue is one of the most hydrated of all tissues in the human body and is one of the maximum hydrated of all tissues withinside the human frame.
What is intracellular fluid?The maximum ample cation in intracellular fluid is sodium. Solutes, irrespective of size, are capable of pass freely among booths due to the fact water includes them alongside the osmotic gradients.
Adipose tissue carries approximately 10% of water, even as muscle groups carries approximately 75%. In Netter's Atlas of Human Physiology, frame water is damaged down into the subsequent booths: Intracellular fluid (2/three of frame water) is fluid contained inside cells.
To read more about the Adipose tissue refer link :
https://brainly.com/question/546428
#SPJ4
Florida experiences a lot of rain in the summer months. How do plants respond to this?
Answer:
They Start to Sprout and bud
Answer:
They grow more and produce flowers or fruit.
Explanation:
I got it right on my quiz haha
Hope this helped/helps!!
Have a nice day alsooo!
Could melanin granules be moved by dynein and kinesin along an actin microfilament?.
We can confirm that melanin granules could in fact not be moved by dynein and kinesin along an actin microfilament.
Why can these substances not be moved along a microfilament?This has to do with the fact that these proteins are specific to microtubules, and therefore are not able to move along microfilaments. This is why the dynein and kinesin motor proteins would not be able to transport the granules along microfilaments.
Therefore, we can confirm that melanin granules could in fact not be moved by dynein and kinesin along an actin microfilament.
To learn more about microfilaments visit:
https://brainly.com/question/13823438?referrer=searchResults
How does a comparison of bone structures of two animal provide evidence of an evolutionary relationship
Answer: Comparative Anatomy
Both provide evidence for evolution. Homologous structures are structures that are similar in related organisms because they were inherited from a common ancestor. These structures may or may not have the same function in the descendants.
Explanation: hope it helps
mark me as brainliest ^_^
Over the course of evolution, the bones of the animals undergo a gradual change in shape as well as in size. But still, two closely related animals have an identical overall layout of the bone.
What do you mean by Evolution?Evolution may be defined as a gradual process that involves changes or modifications in the members of the same or different species over a long period of time.
The bones of descent common ancestors reveal the evolutionary relationships among the animals. In relationship involves homologous and analogous structures.
The homologous structure reveals the structural similarity between the animals, while the analogous structures reveal the functional similarity.
Therefore, it is well described above.
To learn more about Evolutionary relationships, refer to the link:
https://brainly.com/question/26125007
#SPJ2
can the shape of globin change ?
Answer:
People with the sickle cell mutation in both copies of the HBB gene produce proteins that clump together and lead to changes in the shape and behavior of red blood cells.
Hey Adam are we good with you and I hope your?
Answer: yo whatever you’re going through, just don’t apologize on brainly
Explanation:
True or False: In a box and whisker plot, 50% of the data is between Q1 and the median
Answer:
Minimum = 0%
Q1 (Lower Quartile) = 25%
Median = 50%
Q3 (Upper Quartile) = 75%
Maximum = 100%
That is true. In a box and whisker plot, Q1 is the first quartile (first 25% of the data) is between the lower quartile (Q1) and the median. The median is the middle, so 50% will fall between Q1 and the median. It's important to understand the various measures of central tendency and how they can be used to analyze the spread of data within a given set, which can provide valuable insights and understanding about the overall trends present within the data.
S
11. Evaluate how a person's blood calcium levels
would be affected if his or her thyroid gland
stopped working.
our thyroid glands plays a main role in a human body. It secretes thyroxine and calcitonin. In which thyroxine help in growth and cellular metabolism and calcitonin helps to regulates calcium concentration in blood . If thyroid gland stops working then there is low level of calcium in our blood, which leads to mental and hormonal disorder. In this way a person's blood calcium level would be affected if his/her thyroid gland stops working.
What prevents the blood in veins from flowing in the wrong direction?.
Answer:
The heart valves
Explanation:
The heart valves prevent blood from flowing in the wrong direction in the heart. The valves are held in the proper place because of the chordae tendinae.
Identify the independent variable in the experiment represented in Figure 3B. Justify the use of hair from individuals unaffected with FT as the control in the experiment represented in Figures 3A and 3B. Based on the data in Figure 3B, describe the FT effect of the disorder on the proportion of hairs in the growth phase. Based on Figure 2, if individuals 3 and 4 have another child, calculate the probability that the child will be affected
Based on the experimental data, the independent variable is the protein fibroblast growth factor-5, FGF5 which is unaffected by hair growth.
What is FT?Familial trichomegaly, FT, is a genetic disorder which results in abnormally long eyes in affected individuals.
FT is caused by a mutation in the genes that coded for the protein fibroblast growth factor-5, FGF5.
In research, the independent variable is unaffected by changes in another variable, butis changed and controlled by the researcher.
Based in the experiments, the independent variable is the protein fibroblast growth factor-5, FGF5.
Therefore, the independent variable is the protein fibroblast growth factor-5, FGF5 which is unaffected by hair growth.
Learn more about independent variable at: https://brainly.com/question/82796
Which of the following is the most likely flow of energy in an aquatic ecosystem? a. phytoplankton → mammal → zooplankton → fish b. phytoplankton → zooplankton → fish → mammal c. zooplankton → phytoplankton → mammal → fish d. mammal → fish → zooplankton → phytoplankton
The flow of energy in an aquatic ecosystem phytoplankton → zooplankton → fish → mammal.
What does the bottom-up model?The bottom-up effect means that a lower trophic level in the biological network affects the community structure of higher trophic levels by means of resource restriction.
whereas the top-down effect refers to a higher trophic level that influences the community structure of a lower trophic level through predation.
Thus, opotion "B" is correct.
To learn more about the bottom-up model click here:
https://brainly.com/question/5364844
When pigs reproduce, which two types of cells pass on information from the pigs to the piglets?
Answer:
nuclei
Explanation:
Nuclei male and nuclei female to create a zygote
The two type of cells that pass on information from the pigs to the piglet is the male and female reproductive cells.
What is male and female reproductive cell?The male and female reproductive cell contains information about the parents that are passed on to the offspring.
The piglet inherit some genes from both parents through their cells.
Therefore, The two type of cells that pass on information from the pigs to the piglet is the male and female reproductive cells.
Learn more on reproductive cell,
https://brainly.com/question/1601480
#SPJ6