‘Without any doubting or quiddit,’ What does ‘quiddit ’mean? a. A quiet laugh b. Without any prediction c. An objection d. A sarcastic answer to a question

Answers

Answer 1
The answer would be the letter c

Related Questions

Some people believe it is important to work with others as team. Others say it is more important to be able to work by yourself. What do you think? Give reasons and specific examples in your answer essay

Answers

Answer:

I think it is important to work as a team because,a lot of ideas are being brought up not as compared to working individually.And as the saying goes"two heads are better than one".

Explain this expression in your own words.
a place less prone to water scarcity"


Enter your answer

Please please help me

Answers

An area or destination where water shortage isn’t that prevalent.

Stanton is determined to learn the things boys do to gain her father's acceptance

Answers

Sometimes... when boys insult you, it actually means they like you - but only sometimes! I agree with the answer above. Some boys do annoying things so that they can get your attention. Some boys do annoying things to others so that they can gain acceptance and attention from other more popular boys.

List 10 vices/ evil traits Old Major gives in his speech​

Answers

Answer:

According to Old Major, the evil traits of man included;

1. Living in a house

2. Sleeping in a bed

3. Drinking alcohol

4. Wearing clothes

5. Smoking tobacco

6. Engaging in trade

7.Touching money

8. Killing fellow animals

9. Tyranny

10. Disunity

Explanation:

When Old Major gave his speech in the book, 'Animal Farm', he basically incited hatred against man amongst the animals. He did not like the fact that Man did not produce anything but was always consuming and using the animals for his own selfish purpose. He wanted the animals to revolt against Man but in doing this, he did not want them to become like Man. Thus, he listed several vices of man that he hoped the animals will never adopt.

For him, anything that walked on two legs was to be hated while anything that walked on four legs or flew was to be loved.

Various protuberances, such as rocks, bushes, and ledges, made it easier for the climber to get up the wall.

Answers

things that stick out

Answers:  

✔ things that stick out

✔ greed

 

✔ flood

 

Read the excerpt from a speech to the school board about the art department. Art is the foundation of what it means to be a human. So many things try to push their way into being more important. We need to refocus ourselves and reevaluate our priorities. We should not cut the funding to the school's art department, because the students will suffer. Everyone thinks that art class is just fun and games. We always think that we need to prioritize everything else first. But it is everything else that will suffer when we lack art and beauty in our lives. Which ideas from the excerpt would be most appropriate to include in a summary? Select two options.

Answers

Answer:

A) "Art is the foundation of what it means to be a human."

B) "We should not cut the funding to the school's art department, because the students will suffer."

Explanation:

In the given excerpt from the speech, the speaker talks about the importance of the art department. In the speech, the speaker also talks about why he thinks it is important not only important for academic life but also for life as well.

For the summarized version, the two sentences most appropriate to be included are

"Art is the foundation of what it means to be a human"

and

"We should not cut the funding to the school's art department, because the students will suffer."

Thus, the correct answers are options A and B.

Answer:

A & B

Explanation:

i did it

1.
Which of the following is a strong thesis statement?
A. Inherit the Wind is a play about racism.
B. Why is U2 one of the most popular bands in the world?
C. Tax reform is not an adequate solution to America's current economic
problems
D. This paper will examine the causes and effects of the Civil War.

Answers

Answer:

C

Explanation:

Write 2 sentences using the Present Perfect tense with the elements you prefer​

Answers

Answer:

I like horror movies.

I have lots of ideas.

Explanation:

Answer:

I have seen the movie that was nominated for this year .2- They haven't gone to the mall

plz answer me from the photo​

Answers

Answer:

1) a buzzing bee

2)my closet

3) the eye doctor

4) the houseplant

5) the space alein

6) a gray dolphin

7) my mother

8) my notebook

9) a big spider

Which phrase from the passage contains a feature of Anglo-Saxon culture?

Please post this by answering ACCURATELY, WHY B is correct or with a wholesome quote from Chuck Norris.

Answers

Answer:

"Men are like steel. When they lose their temper, they loose their worth."

- Chuck Norris

Explanation:

I am not too sure why B is correct. But I hope you enjoy the Chuck Norris quote!

Read this excerpt from "The Medicine Bag.”

All I could do was stand there with the whole neighborhood watching and shake the hand of the leather-brown old man. I saw how his gray hair straggled from under his big black hat, which had a drooping feather in its crown. His rumpled black suit hung like a sack over his stooped frame. As he shook my hand, his coat fell open to expose a bright red satin shirt with a beaded bolo tie under the collar. His get-up wasn’t out of place on the reservation, but it sure was here, and I wanted to sink right through the pavement.

Which is a symbol of the grandpa's heritage in this excerpt?

the handshake
the drooping feather
the rumpled black suit
the neighborhood

Answers

The dropping feather

Answer:

its b i took the test

Explanation:

HELP I NEED THIS FOR ENGLISH SO WHAT IS THAT LIKE GANG CALLED IN THE OUTSIDERS I THINK IT HAS TIGER IN IT LIKE TIGER STREET GANG OR SOMETHING I NEED TO KNOWWW

Answers

Answer:

The Greasers?

Explanation:

I think the only "gang" in the outsiders is the greasers could be wrong though

Answer:

Is it the Socs gang?

Explanation:

Can someone proofread this for me?


According to studies, 93% of young people use the internet to engage with people or share their online creations. This demonstrates how technology is used as a constructive outlet by numerous young people. Despite the fact that over sixteen percent of teenagers say they have been cyberbullied, the majority of them utilize technology to communicate with distant family members or establish new friends. As a result of technology, many young people in our generation have become more outspoken. People may, for example, utilize the internet to raise awareness or share their views on social problems that are highly passionate, contentious, and current.​

Answers

Answer:

plz help me in find the number whose product with the 2/211 gives 8/11

What usually creates or communicates mood in a short story?

Answers

Answer:

dialogue

Explanation:

mood is set by characters, tone is set by author

The details used in the story to describe the setting (basically the dialogue of the story) creates the mood in a short story.

What structural elements are missing from the text in praise of slacking?

Answers

Answer:

hello!your answer is in the attachment

20 pts + BRAINLIEST!!


Read the passage.


Looking back, I suppose my life started with that letter. I don’t think everything necessarily happens for a reason—there’s too much tragedy in the world for that. But there’s no doubt that some misfortunes turn into pivotal moments that can alter the course of a person’s life for the better. Alma and I have been together for 30 years now, and I still wonder what that other life—the one in which my letter said “congratulations”—might look like. I expect it would have been pretty grand, full of its own triumphs and pitfalls. My children are fresh to the adult world, and when I see their tears as plans go sideways, I like to imagine that someday they’ll sit where I am with people to love, hobbies to pursue, and maybe even a spare dollar in the bank.


Which statement best describes the narrator’s viewpoint regarding obstacles his children face?


A. He ignores their struggles with obstacles because he believes everything happens for a reason.


B. He works to help his children avoid obstacles so that they will never have to wonder how their lives could have gone.


C. He fears the obstacles and worries that life will not turn out as well for his children as it did for him.


D. He regards the obstacles calmly, with the perspective of someone who has faced obstacles and lived through them.


((( I report spam answers )))

Answers

Answer:

Explanation:

Let's start with the answer. It has to be D.

The key sentence is this one:

My children are fresh to the adult world, and when I see their tears as plans go sideways, I like to imagine that someday they’ll sit where I am with people to love, hobbies to pursue, and maybe even a spare dollar in the bank.

He's calm because he's been through it all before. Most of all, he knows that this to will end -- whatever problems his children have are only momentary. (As an aside, I would like to hear what his wife says).

A: Not the answer. He doesn't ignore the troubles. If he believes it happens for a reason, he doesn't say what it is.

B: Not the answer: Nowhere does it say anything about future considerations or at least that one.

C: He doesn't fear for them. He has a calm confidence that they will work through it. Not the answer.

Your neighbor's house is on fire. * LIFE-SAVING SOLUTION: How do you respond to an emergency? Whom do you call for help?

Answers

I would call 911 and tell them that the neighbors house is on fire and from there they would tell me how to proceed

Answer: Read Below

Explanation: The first thing to do in any situation of emergency is to call 911. Give the operator the address, who you are, how many people may possibly be in the house, and wait for their further instructions. They will probably tell you to not go towards the fire and wait until authorities get there. Make sure nobody goes near the house, and if somebody comes out, help them best you can. That is the extent of what you are supposed to do, in order to keep yourself safe, and not get in the way of the first responders.

Hope this helps!

What idea is emphasized by the connotations of the underlined words?

Answers

Answer: D. Women can change their circumstances by making different decisions.

Explanation:

The two rate were placed in a cage and then fed different types of milk. One rat got ordinary milk and ended up being furtive, timid and small and the one that got grade A milk was glossy, bold and big.

The connotation here in relation to women is that if women want to change their circumstances and relatively become like the bigger and bolder rat, they should make different decisions that will get them better opportunities like the grade A milk that the bigger rat got.

Tell a story about a song that you use to listen when you had troubles

Answers

Answer:

"Alone in a Room"

Explanation:

When I was younger and in school, I had alot of bad days, like most people at that age. This was due to both social and academic problems. I would usually go home and listen to the song "Alone in a Room" on repeat. I loved the acoustic version of this song as it was very melodic and the lyrics really spoke to me. It talks about feeling overwhelmed and stressed, but finally understanding that in order to move on you need to air out everything that you are holding in. Sitting alone in a room and getting everything off your chest in a creative way is always the best choice.

If anyone can help ! Plz

Answers

Answer: A

Explanation:

Because  a

By studying the suffix, the reader can determine that "impetuous" most likely means

Answers

Answer:

Impetuous means, acting or done quickly and without thought or care.

Explanation:

Answer:

“someone who acts without impulsiveness or emotion.”

Explanation:

Determine the intercepts.

x-intercept =

y-intercept =

Answers

The awnings are not good

Read the following excerpt from "The Cask of Amontillado" and answer question.
THE thousand injuries of Fortunato I had borne as I best could, but when he ventured upon insult I vowed
revenge. You, who so well know the nature of my soul, will not suppose, however, that gave utterance to a
threat. At length I would be avenged; this was a point definitely, settled --but the very definitiveness with
which it was resolved precluded the idea of risk. I must not only punish, but punish with impunity. A wrong is
unredressed when retribution overtakes its redresser. It is equally unredressed when the avenger fails to
make himself felt as such to him who has done the wrong.
It must be understood that neither by word nor deed had I given Fortunato cause to doubt my good will. I
continued, as was my in to smile in his face, and he did not perceive that my smile now was at the thought of
his immolation.
In
1
What type of irony is evident in the excerpt above?
2
dramatic irony
situational Irony
O verbal irony
O none of the above

Answers

C. verbal irony

hope this helps

Write 10 lines about Nelson Mandela.​

Answers

[tex]\sf \bf {\boxed {\mathbb {NELSON\:MANDELA:}}}[/tex]

ඞ  I am so sorry for the inconvenience. It kept saying "it's rùde'', although I haven't written anything rùde in there.

ඞ Kindly refer to the attached file.

[tex]\red{\large\qquad \qquad \underline{ \pmb{{ \mathbb{ \maltese \: \: Mystique35♛}}}}}[/tex]

Explanation:

Nelson Rolihlahla Mandela was born on 18 July 1918 in the Transkei village close Umtata. Nelson Mandela was sent to Healdtown, a Wesleyan secondary school with some reputation where he enrolled after getting a primary education at a local mission school. He then registered for the Bachelor of Arts degree at Fort Hare University College where he was appointed to the Representative Council of the Student. Also, he was suspended for joining a protest boycott from college. He went to Johannesburg where, by correspondence, he finished his BA, took clerkship papers and began studying for his LLB. The Nelson Mandela essay is an insight into the life and works of the great man.

Nelson Mandela essay

The greatest pleasure of Nelson Mandela, his most private moment, is to watch the sunset playing with the music of Händel or Tchaikovsky.

During daylight hours locked up in his cell, deprived of music, he was denied these two simple pleasures for centuries. Concerts were organized with his fellow inmates as far as possible, especially at Christmas time, where they would sing.

Nelson Mandela finds music very uplifting and is interested in European classical music as well as African choral music and the many talents in South African music. But above all, one voice stands out – Paul Robeson’s, whom he defines as our hero.

The years in prison strengthened already engraved practices: athlete’s disciplined eating system started in the 1940s, as did the early morning practice. Nelson Mandela is still up by 4.30am today, regardless of how late he worked last night.

He started his exercise routine by 5 am, which lasts for at least an hour. Breakfast is at 6.30 when newspapers are read during the days. With a normal working day of at nearly 12 hours, time management is critical and Nelson Mandela is highly impatient with impunctuality, considering it to be insulting to those with whom you deal.

HOPE IT HELPS U MATE ☃️☃️

Complete the sentence using will/won't or may/might.
1. I _____ visit you when I come to Mexico. I'm not sure.
2. I probably _____ study engineering in college. It's a field that interests me.
3. It's raining, so we _____ go swimming today.
4. _____ you and Chris get married in the future?
5. My friend are going the movies. I _____ go with them, but I'm not sure yet.
6. The banks _____ be open on Monday because it's a holiday.
7. Toshiro _____ definitely get the job because he speaks Japanese.
8. Kara _____ get a full-time job after hight school, but her plans aren't certain.​

Answers

Answer:

1. I may visit you when I come to Mexico. I'm not sure.

visit you when I come to Mexico. I'm not sure.2. I probably will study engineering in college. It's a field that interests me.

study engineering in college. It's a field that interests me.3. It's raining, so we won't go swimming today.

go swimming today.4. Will you and Chris get married in the future?

you and Chris get married in the future?5. My friend are going the movies. I may go with them, but I'm not sure yet.

go with them, but I'm not sure yet.6. The banks won't be open on Monday because it's a holiday.

be open on Monday because it's a holiday.7. Toshiro will definitely get the job because he speaks Japanese.

definitely get the job because he speaks Japanese.8. Kara might get a full-time job after hight school, but her plans aren't certain.

Explanation:

This is all correct!

please give me one of ______. a.that b.those c.this d.these​

Answers

Answer:

it is those

Explanation:

Khi nào sửa dụng thì present simple

Answers

Answer:

Thì hiện tại đơn (Simple present tense) dùng để diễn tả một sự thật hiển nhiên hay một hành động diễn ra lặp đi lặp lại theo thói quen, phong tục, khả năng.

Question 8 of 20 Which story idea best fits the traditional definition of tragedy O A. An executive runs his business into the ground because of his arrogance. O B. A high school student starts having a bad day that just gets worse and worse O c. A couple is about to get married, but the groom leaves the bride at the altar. O D. An old woman is careful to wrap up all her affairs in life before her death PREVIOUS​

Answers

Answer:

c. A couple about is about to get married, but the groom leaves the bride at the altar

The answer is C. A couple is about to get married but the groom leaves the bride at the alter

Write a paragraph on Diary entry ​

Answers

Diary entries are a collection of pages in a diary. The diary entries are usually organized according to the date and time of when it was written. Depending on the diary types, each entry holds contents ranging from thoughts, emotions, reflections, dreams and so on.

MARK ME AS BRAINLIEST.

A diary entry is a section of writing that has been organized by date. The entries within your diary are how you organize the thoughts, feelings and opinions you are pouring into it. They break up your diary into smaller pieces. Think of them like chapters of a book. They can be as short or as long as you want.

What word does NOT describe Juliet in Act III of Romeo and Juliet?

A. Optimistic
B. Strong
C. Love sick
D. Confused

Answers

The answer Is D. Confused

D. Confused not describe Juliet in Act III of Romeo and Juliet.

In Act 3, scene 1 of Romeo and Juliet, Romeo's brand new marriage gets complicated because of the feud, or long-standing fight, between the Capulets and Montagues. He tries to keep peace because Tybalt, a Capulet, is now related to him by marriage, but he feels a strong sense of revenge after Tybalt kills Mercutio

What are three important events in Act 3 of Romeo and Juliet?

Benvolio and Mercutio (Montague faction) meet Tybalt (Capulet faction). Mercutio is killed by Tybalt. Romeo revenges the death of Mercutio and kills Tybalt. Prince of Verona banishes Romeo from Verona.

How does Act 3 end in Romeo and Juliet?

Overcome by love, Romeo responds that he will stay with Juliet, and that he does not care whether the Prince's men kill him. Faced with this turnaround, Juliet declares that the bird they heard was the lark; that it is dawn and he must flee.

To learn more about Act III of Romeo and Juliet, refer

https://brainly.com/question/21866988

#SPJ2

Other Questions
part ion even know of the hardest test Which of the following describes the parabola with the equation y = x2 3x + 6? A) The axis of symmetry is x = 1.5 and the vertex is (1.5, 12.75). B) The axis of symmetry is x = 1 and the vertex is (1, 3). C) The axis of symmetry is x = 1.5 and the vertex is (1.5, 8.25). D) The axis of symmetry is x = 0 and the vertex is (0, 6). Find the next term of the sequence.21, 15, 9, 3, . . 6603 How many countries in this World? Can you help me with this please (finals) The termite gut environment is lacking a fresh supply of oxygen O2. However, it is rich with food due to the presence of bacteria that contain enzymes capable of breaking down cellulose and lignin, the macromolecules that make wood. Use this information to determine which of following protista groups is more likely to be found in a termite gut.a. Diatoms b. Radiolaria c. Parabasilids d. Rhodophyta e. Foraminifera (Forams) Ifthe fish commission states that the mean length of all fish in spring run is mean =15cm,withthe standard deviation of variance=4cm,what will be the probability that a fish is caught in spring run :between 15cm&19cm? The main objective of most informational texts is to entertain the reader.Please select the best answer from the choices providedF Barry Boots Inc. is considering adding a new line of boots. Based on preliminary market research, management has decided that each pair of boots should be priced at $300. Furthermore, management believes that the profit margin should be 30 percent of sales revenue.What is the target cost?a. $150.75b. $225.50c. $260.00d. $157.50 Cho hai in tch q1=q2=8.10^-7 C t cch nhau 5cm. Xc nh cng in trng ti im:a. Cch q1=2cm, q2=3cmb. Cch q1=5cm, q2=10cmc. Cch q1=5cm, q2=5cmd. Cch q1=4cm, q2=3cm Why does Australia have such unique biodiversity (variety of animals and plants) in its fauna and flora? Apothem=A) 4 units B) 4 (square root) 2 units C) 4 (square root) 3 units Solve for x. 8x = 35 A brick staircase has a total of 17 steps The bottom step requires 131 bricks. Each successive step requires 5 less bricks than the prior one. How many bricks are required to build the staircase? Evaluate x2+9/x2 for each of the given values.What is the value of the expression when x = 3?2310undefinedWhat is the value of the expression when x = 1?2310 undefinedWhat is the value of the expression when x = 0?2310undefined A supervisor is suspicious of a new female employee in an automotivecompany. This is an example of...DiscriminationDiversityPrejudiceTolerance Four relatively recent fossil species were recovered, and when the DNA was extracted, investigators observed that Species W and Z both had long finger bones, and species X and Y had short finger bones. Based upon this information and the hypothetical molecular data below, sequenced from common regions in one gene of their DNA, which two species are the most closely related to each other?Species W:AACATTGCTTTTGTAACGAASpecies X:AACCGCGCGTTTGGCGCGCASpecies Y:AGCAGCGCTTTCGTCGCGAASpecies Z:AACCGCGCTTTTGGCGCGAAA) Species X and ZB) Species W and ZC) Species Y and ZD) Species X and Y Our town has ____ museum we could visit Which of the relations below is a function? *2 points{(2, 3), (3, 4), (5, 1), (2, 4)}{(2, 3), (3, 4), (6, 2), (7, 3)}{(2, 3), ( 3, 4), (6, 2), (3, 3)}{(2, 4), ( 3, 4), (6, 3), (3, 3)} PLEASE HELP, WILL GIVE BRAINLIEST FOR RIGHT ANSWER!Indicate the equation of the given line in standard form, writing the answer in the equation box below. The line that contains the point Q (1, -2) and is parallel to the line whose equation is y 4 = 2/3 ( x 3)