Write down the equation of the straight line which passes through (0, -3) and parallel to the straight line y = -2x+1​

Answers

Answer 1

Answer:

y = -2x - 3

Step-by-step explanation:

Equation of line:

   Parallel lines have same slope.

  y =  -2x + 1

Compare with the equation of line in slope intercept form y = mx + b

Here m is the slope and b is the y -intercept

 m = -2

m = -2  ; line passes through (0 , -3)

Equation of line in slope intercept form:

             [tex]\sf \boxed{\bf y - y_1=m(x-x_1)}[/tex]

             y - [-3] = -2(x - 0)

                 y +3 = -2x

                       y = -2x - 3


Related Questions

9. Teresa was taking her two children to the zoo. She purchased 1 adult ticket for herself and 2 children's
tickets for a total of $18.20. A family of 5 was also visiting the zoo. -The family purchased 2 adult tickets and
3 children's tickets for a total of $30.90. How much money did an adult ticket cost?

Answers

Answer:

plz mark as brainliest

Step-by-step explanation:

$7.9

A local little league has a total of 60 ​players, of whom 40​% are left​-handed. How many left ​- handed players are​ there?

Answers

Answer:

24 players

Step-by-step explanation:

Answer:

24. 60 X 4/10 is 24

Step-by-step explanation:

7/8m^3 +3-1/2m^3. can u please help me solve this

Answers

Answer:

3m^3/8 + 3

Step-by-step explanation:

It can't be solved but that's the most simplified version.

Answer:

15/8m^3

Step-by-step explanation:

7/8m^3+2/2m^3

7/8m^3+1/m^3

=15/8m^3

2. it's not B
Write a rule for the linear function shown in the graph.



A. y = -5/2x - 1

B. y = 3x – 1

C. y = 2/5x + 1

D. y = 5/3x + 1

Answers

Answer:

Solve for the first variable in one of the equations, then substitute the result into the other equation.

Point Form:

( 0 ,   1 )

Equation Form:

x = 0 ,     y = 1

Step-by-step explanation:

Graph.

y = − 5/ 2 x − 1

y = 3 x − 1

y = 2/ 5 x + 1

y = 5/ 3 x + 1

NEED HELP ASAPPPPPP PLZZZZZ
Right one paragraph on
What is factoring by using GCF?

Answers

Answer:

GCF is the largest factor that all terms have in common.

Pls help me with this math problem

Answers

Answer:

12 ima shoot u

Step-by-step explanation:

A water rocket is launched froni a platform. The height,
h in metres, of the water rocket at time & seconds after
it is launched is h= -212 + 74 + 4. When does the water
rocket hit the ground?​

Answers

Answer:

4.41seconds later

Step-by-step explanation:

Let the equation of the height reached by the water front be h = -2t^2+7t+4

The water hits the ground at h =0

Substitute

0 =  -2t^2+7t+4

-2t^2+7t+4 = 0

2t^2 - 7t - 8 = 0

t = 7±√(-7)²-4(2)(-8)/2(2)

t = 7±√49+64/4

t = 7±√113/4

t = 7±10.63/4

t = 7+10.63/4

t = 17.3/4

t = 4.41s

Hence the water hit the ground 4.41seconda later

HEY GUYS PLS HELP (kinda easy tho)

Answers

Answer:

74

Step-by-step explanation:

13 5-peso coins

9 1 peso coins

13 X 5 = 65

9 X 1 = 9

65+9 = 74

How do I do this??? Sorry for my sloppy hand writing I’m in a rush...and can someone pls tell me if I’m doing this right???

Answers

Lauren jogs at a rate of 2 miles every 2/5 hour. What is her unit rate in miles per hour?

There are a couple of ways to do this. I’ve put one in the picture. Let me know if you have more questions.

Order the following from LEAST to GREATEST: 3/5, -1/2, 0.50, -7/10, -0.75 *

Answers

Answer:

-0.75, -7/10, -1/2, 0.50, 3/5

Answer:

-0.75, -7/10, -1/2, 0.50, 3/5

Step-by-step explanation:

put all of them as a decimal first

3/5 = 0.6 (5)

-1/2 = -0.50 (3)

0.50 = 0.50 (4)

-7/10 = -0.70 (2)

-0.75 = -0.75 (1)

Which values of a and b make the following equation true?

Answers

Answer:

a=11 , b=7

Step-by-step explanation:

When integer multiply with integer, the base were same, then we just add both powers.

for example

[tex]x {}^{2} \times {x}^{3} = {x}^{2 + 3} = {x}^{5} [/tex]

Answer the photo below thanks

Answers

Answer:

You're right, the answer is C.

Step-by-step explanation:

Answer:

C

Step-by-step explanation:

I am not sure if it is B or C, but I can say that it is not A since the figure in A is rotated. Figure in B kinda looks like a reflection then C because if the figures were translated then the corner should be at one side. Sorry if that kinda confused you, but I added a picture of what I am trying to say for the figure in option B. I guess it is C.

Hope this helps, thank you !!

the supplement of a 65° angle has a measure of​

Answers

Answer:

115 degrees

Step-by-step explanation:

supplementary angles add up to 180 degrees, so if x is the angle you're trying to have you get:

[tex]x + 65 = 180\\x = 115[/tex]

There are 4 identical wooden blocks that are 20 inches long, 2 inches wide, and 1 inch thick. If you glue them together, what is the difference of the largest and smallest outer surface area you can get?

Answers

Answer:

Step-by-step explanation:

5 inches wide, and 2 inches thick. if you glue them together(stacked) what is ... If you glue the largest area faces together you will get the smallest overall ... The total surface area of one of the blocks is 2 times 250 square inches plus 2 times ... 720 times 3 is 2160 minus 4 times 250 is 2160 minus 1000 is 1160.

A package weighs 32 ounces. What is the weight of the package in pounds

Answers

Answer:

2 pounds

Step-by-step explanation:

1 pound=16 ounces

Given that ABCD is a parallelogram. Find the following

Answers

Answer:

m=8

m<A=83

m<D=97

Step-by-step explanation:

Angles that are opposite of each other in a parallelogram are equal. Knowing this, we can first conclude that angle A and angle C are equal. We can set up the following equation:

[tex]9m+11=8m+19[/tex]

Subtract both sides by 11

[tex]9m+11-11=8m+19-11\\9m=8m+8[/tex]

Subtract both sides by 8m

[tex]9m-8m=8m+8-8m\\m=8[/tex]

To calculate angle A, plug the value of m into its expression.

[tex]<A=9m+11\\<A=9(8)+11\\<A=72+11\\<A=83[/tex]

In a parallelogram, angles that share a side are supplementary, meaning they add up to 180 degrees. Therefore, angle A and angle D are supplementary. Knowing this, we can set up the following equation:

[tex]180=83+D[/tex]

Subtract both sides by 83

[tex]180-83=83+D-83\\97=D[/tex]

I hope this helps!

PLEASE HELP!!! ILL GIVE BRAINLIEST, EXPLAIN YOUR ANSWER PLEASE

Answers

Answer: -20v^3 - 30x^2 +20

Step-by-step explanation:

simply multiply each term inside of the parentheses by -5.

Answer:

20v³ + 20 - 30x²

Step-by-step explanation:

multiply -5 by all three terms inside parentheses

(-5)(-4v³) + (-5)(-4) + (-5)(6x²)

20v³ + 20 - 30x²

Which of the following expressions are equivalent to 5(m + 3)? hurryy

Answers

Answer:

B   5m + 15

Step-by-step explanation:

Use the distributive property and multiply 5 by both terms inside the parentheses.

5(m + 3) = 5 * m + 5 * 3 = 5m + 15

Answer: B   5m + 15

cuántos encuentros son necesarios para una entrevista completa​

Answers

4 encuentros,creo Ó 2 encuentros.Pero yo creo que 4

What is the radius and diameter of the following circle?

Answers

Answer:

radius=7.5, diameter=13

Step-by-step explanation:

diameter is the length across a circle through the middle, and it is given in the picture. radius is half of the diameter

Which shows the distributive property?

1. 5x + 2 = 2 + 5x

2. 5(x + 2) = 5x + 10

3. 5(x + 2) = 5(2 + x)

Answers

Number 2 because your multiplying the 5 by the numbers in the parenthesis.

The number 6545 can be written as a product of a pair of positive two digit integers. What are these two integers?

Answers

Answer:

77 and 85

Step-by-step explanation:

Since the number 6545 ends in a 5, we can assume that one of the two digit numbers ends in a 5. I tried 55, 65, 75, and 85, and I just divided 6545 by those numbers until I got a two-digit positive integer as my answer,

85 * 77 = 6545

Therefore, the answer is 85 and 77.

I hope this helps!

finding value of x. PQR
P- 2x°
3
3
3

Answers

[tex]\mathfrak{\huge{\orange{\underline{\underline{AnSwEr:-}}}}}[/tex]

Actually Welcome to the Concept of the Equilateral Triangles.

Since, we know that, all the sides of a triangle are equal, hence it is a Equilateral triangle.

Equilateral triangle has one all angles equal to 60°.

so, major angle P = 60°

hence, 2x=60°

===> x = 30°

the output is double the input

Answers

Whats the question???

11. If AB = BC and BC = CD, which property shows AB = CD?

Answers

Answer:

i belive its the transitive property

sry if im incorrect

A toy store had 789 games.
It sold 53 of these games.
How many games are at the store now?
I games
?

Answers

Answer:

736 games are at the store now

Step-by-step explanation:

789-53=736

Answer:

736

Step-by-step explanation:

789-53=736

If you are making broccoli cheese soup the ratio of cheese to broccoli to broth is 5:6:10 if there is 100 parts broth how many of each ingredient should you use

Answers

Answer: See explanation

Step-by-step explanation:

Since there are 100 parts broth, the number to use for each ingredients will be:

Cheese = 5 × 100/10 = 5 × 10 = 50

Broccoli = 6 × 100/10 = 6 × 10 = 60

Broth = 100

The diagram at right shows a regular
hexagon
What is the area of the shaded region?
Round your answer to the nearest tenth.
I
20
20
Apothem Length: 10,3

Answers

Answer:

Nice

Step-by-step explanation:

1) Resolva as expressões numéricas. Não esqueça de deixar os cálculos.
a) 2 + 8-3-5 + 15 =
b) 12 + (35 - (10 + 2) +2] =
c) [(18+32) + 8 +5 3] + 6 =
d) 37 + (-25 - (-11 + 19 - 4)] =
e) 60 = {2 • (-7 + 18 = (-3 + 12)]} - [7 • (-3) - 18 = (-2) + 1) =
f) -8 +{-5 + [(8-12) + (13 + 12)] - 10) =​

Answers

Answer:

a=17

b=37

c=117

d=8

e=

f=-2

If x= 1/3 is one of the solutions of an equation then what is the factor that gave us this solution

Answers

Answer:

3x - 1 = 0

Step-by-step explanation:

If x = 1/3

multiply both sides by 3

3 * x = 1/3 * 3

3x = 1

Subtract 1 from both sides ;

3x - 1 = 1 - 1

3x - 1 = 0 ( the factor which gives the solution)

3x - 1 = 0

3x = 1

Doavide both sides by 3

3x / 3 = 1/3

x = 1/ 3

Other Questions
the fan blades on a jet engine have a moment of inertia 30.0 kg-m 2 . in 10 s, they rotate counterclockwise from rest up to a rotation rate of 20 rev/s. a). What torque must be applied to the blades to achieve this angular acceleration?b). What is the torque required to bring the fan blades rotating at 20 rev/s to a rest in 20 s? the chemical analysis of a macromolecule has been provided. what is this macromolecule? It is known that amounts of money spent on textbooks in a year by students follow a normal distribution with mean $400 and standard deviation $50. Find the shortest range of dollar spending on textbooks in a year that includes 60% of all students. Choose the example that is punctuated correctly.I am writing a report with a coworker. Because we are going to use the criteria organization method we have to examine each plan by the same standard.I am writing a report with a coworker. Because we are going to use the criteria organization method, we have to examine each plan by the same standard.I am writing a report with a coworker because we are going to use the criteria organization method, we have to examine each plan by the same standard. Fantasy essay 200 words Calculate the ph of a solution containing 20 ml of 0.001 m hcl and 0.5 ml of 0.04 m sodium acetate. give the answer in two sig figs. 20 pts) determine the moment of f = {300i 150j 300k} n about the x axis using the dot and cross products. A force F of 10 N is applied in the direction indicated, per meter depth (into page). The 300 mm long triangular beam is Aluminum, 1100 series, and extends 2 meters into the page. What is the moment about point A, per meter of depth? The system is on Earth, at sea level, gravity acts in the direction of F.Note: The centroid of a triangle is located at h/3.A) 16 Nm/mB) 19 Nm/mC) 24 Nm/mD) 27 Nm/m What is the measurement of N? it is common for a developer to hold back funds before making final payment to ensure that subcontractors perform all work completely. group startstrue or false a 75 year old patient is complaining of shortness of breath. vital signs are bp 160/88, p 130, and r 22 with crackles in the bases of the lungs. you should A client who is anticipating total hip replacement is considering autologous transfusion. When teaching this client about autologous transfusion, it is important to emphasize that?-It reduces the risk of mismatched blood-A hemoglobin level above 9.5 mg/dL is required-there is no need to test the blood for infectious diseases-Donations may be made every other day PWEEZ helpBased on the results of the second simulation, if 224 groups are formed, about how many of them would you expect to contain all girls? Round your answer to the nearest number of groups true/false. the number of levels of observed x-values must be equal to the order of the polynomial in x that you want to fit. If the Watson strand for a double stranded DNA is 5 ATGGTCATGGGTTCCAATGCA 3, what is the sequence of the Crick strand? Find the center of mass of a thin triangular plate bounded by the coordinate axes and the line x + y = 9 if (x,y) = x + y. A)x=2,y=2B) x=54,y=54C)x=98,y=98D)x=1,y=1 Assuming the medium fertility variant, which group of countries will have a decrease in population by 2100, compared to 2015 levels? Choose all that apply.1. Low-income countries2. Lower-middle-income countries3. Upper-middle-income countries4. None of the groups of countries will decrease. A triangle has a side lengths of 21 miles, 28 miles, and 35 miles. Is it a right triangle? Because prices change over time, costs reported for these accounts tend to differ among inventory cost methods A slender bar of mass m and the length l is resting on a smooth horizontal surface, and a horizontal force F is applied perpendicular to the bar at the A. If m = 0.5kg, l = 0.3m, and F = 1.2 N, calculate the magnitude of the acceleration of end B at the instant when F is applied. Present your answer in m/sec^2