compare and contrast books to tv​

Answers

Answer 1
Books don’t have ads and revenue that company’s makes off advertisements. Books are cheaper and u could learn from books. Both TVs and books provide information. TVs are more modern and more fun to use

Related Questions

Oxygen and carbon dioxide that are recycled by the oxygen and carbon dioxide cycles are used in cellular respiration and photosynthesis.
true
false​

Answers

Oxygen and carbon dioxide that are recycled by the oxygen and carbon dioxide cycles are used in cellular respiration and photosynthesis.

the answer is "true"

who is known as father of school ?​

Answers

Answer:

Horace Mann

Explanation:

Answer:

Horace Mann

Explanation:

I looked it up

I WILL GIVE BRAINLIEST
The lines of constant pressure shown on the surface pressure diagram are called ___
isobars
pressure lines
fronts
stationary lines

Answers

Answer:

pressure lines

Explanation:

Isobars are found ONLY on surface charts. They most commonly connect lines of equal pressure in the units of millibars. High pressure isobars generally occurs with isobars above 1010 mb while low pressure isobars occur with lower than 1010 millibars.

Answer: isobars . Because I got it write on my lesson

Which statement correctly describes the impact of Hinduism and Confucianism on society?
Both Hinduism and Confucianism divided Indian society into different castes.

B.
Both Hinduism and Confucianism promoted the principles of democracy in society.

C.
While Hinduism promoted the concept of harmony in China, Confucianism divided Indian society into different castes.

D.
While Hinduism divided Indian society into different castes, Confucianism promoted the concept of harmony in China.
please try your best bc this is for a grade if i pass ill give everyone who answered brainliest

Answers

I think its B Or C but if I know I will tell you

can yall help me on this plsssss

Answers

Answer:

It's either A or C

Explanation:

Because the answer A would mean they would have to keep their crops alive

in order to survive and the other options like  B, and D those don't make any sense so it's either A or C. Hope this helps!

Why was Hitler known as one of the smartest humans on Earth? pls this is worth 20 points

Answers

Answer

he was very smart

Explanation:

One century ago, Adolf Hitler fighting in the Great War. He was a good soldier — he would be promoted to the rank of corporal, be wounded two times, and be awarded six medals. And with him during the war he had the writings of philosopher Arthur Schopenhauer.

The image of Hitler reading Schopenhauer is startling, as one popular depiction of Hitler is of a semi-literate, semi-sane outlier who somehow lucked and manipulated his way to power in Germany. Certainly after the devastation of World War Two and the horrors of the Holocaust, it’s tempting to think that those who caused them must be close to crazy and to dismiss the possibility that educated people could be responsible.

But if we are going to fully understand the causes of National Socialism and other horrors, we have to consider an unsettling possibility: Maybe those who commit them, like Hitler and his accomplices, can be highly intelligent, well educated, and think of themselves as noble idealists.

Also according to Kubizek, Hitler was registered with three libraries in Linz, Austria after the war, and spent much of his time in Vienna in the Hapsburgs’ court library. “Books were his world.”

The phenomenon of bookish young men and women becoming activists for political violence is not rare. Consider these geographically varied examples:

* Pol Pot, the genocidal dictator in Cambodia, was an indifferent student but received part of his education in Paris and upon his return to Cambodia taught French literature and history at a private college.

* Abimael Guzmán, leader of Peru’s Shining Path terrorist group, wrote a dissertation on Kant and became a professor of philosophy at a Peruvian university.

* Osama bin Laden — who was a university graduate with a degree in civil engineering — read the works of theologian Seyyid Qutb. At university in Saudi Arabia, bin Laden attended regularly the lectures of Muhammad Qutb, who was his brother Seyyid’s translator and editor as well as professor of Islamic Studies.

* And Josef Goebbels attended five of the best universities in Germany and received his Doctor of Philosophy degree from the University of Heidelberg.

What functions do interest groups serve?

Answers

Answer:

A special interest group (SIG) is a community within a larger organization with a shared interest in advancing a specific area of knowledge, learning or technology where members cooperate to affect or to produce solutions within their particular field, and may communicate, meet, and organize conferences.

Explanation:

Answer:

An interest group is a group of people who try to affect congress's public policy on certain subjects and laws

Explanation:

please help me i need this ASAP

Answers

Answer:

What does the policy of isolationism emphasize? The belief that political ties to other countries should be avoided

Answer:

C. The belief that political ties with other countries should be avoided.

Explanation:

list five ways of living a chaste life​

Answers

Answer:

Get to know yourself before you get to know someone else

Be friends first

Discuss your boundaries before you start dating

Avoid tempting situations

Date with other people around

Explanation:

Five ways of living a chaste life are:-

Get to know yourself before you get to know someone elseBe friends first.Discuss the boundaries before starting to date.Avoid tempting situations.Date with other people around

What does life of chastity mean?

Chastity is a much different topic today than it was for our forefathers. Showing a little too much shoulder or ankle when our grandparents or great-grandparents were dating was considered scandalous, let alone flaunting all of that on TV or on stage.

It was much more common back then to postpone sexual relations until after marriage. This practise of abstinence has fallen out of favour in recent years, making it much more difficult for those who want to save themselves until after marriage to adhere to their standards.

Make a commitment to each other, and establish boundaries. Avoid spending time alone, enlist the help of friends and family, and being open with someone is one of the best ways to stay in control of our body and our relationships.

Therefore, five ways of living a chaste life​ is listed above.

To learn more about chaste life, click here:

https://brainly.com/question/466130

#SPJ2

What conclusions have historians drawn about early civilization in the indus river valley, and why don't they know more?

Answers

Historians have not been able to read the Harappan language, so they do not know much about the Harappan civilization.

is a system of government in which priests rule in the name of God or a god.

a. Theocracy
b. Monarchy
c. Oligarchy
d. Democracy

Answers

Answer:

A. theocracy

Explanation:

Someone rules under the name of God

When does a bill go to the governor for approval?

after it has been approved by one house
after it has been approved by both houses
after it has been discussed in a house committee
after it has been drafted by one of the two houses

Answers

Answer:

B

Explanation:

Trust the way

Answer:

b

Explanation:

Where did the Roman Empire begin? Include the city and country.

Answers

Beginning in the eighth century B.C., Ancient Rome grew from a small town on central Italy's Tiber River into an empire that at its peak encompassed most of continental Europe, Britain, much of western Asia, northern Africa and the Mediterranean islands.

Answer:

City: Small town in Italy

Country: Italy

Continent: Europe

Explanation:

Beginning in the eighth century B.C., Ancient Rome grew from a small town on central Italy's Tiber River into an empire that at its peak encompassed most of continental Europe, Britain, much of western Asia, northern Africa and the Mediterranean islands. The city of Ancient Rome was built on seven hills: Aventine Hill, Caelian Hill, Capitoline Hill, Esquiline Hill, Palatine Hill, Quirinal Hill, Viminal Hill. It is said that the original city was founded by Romulus on Palatine Hill. At the center of the city and Roman public life was the Forum.

Japanese Perspective: Why wasnt it necessary to use the bombs?
As you re-read the documents highlight or underline quotes, facts, images, information etc that supports the
Hiroshima as Victimization narrative in other words, look for information that proves that America was wrong
to drop the atomic boma Identity at least three reasons and record below:

Answers

The correct answer to this open question is the following.

Although we have not read the documents you did, we can help to answer this question based on our knowledge of the topic.

Japanese Perspective: Why wasn't it necessary to use the bombs?

The Japanese point of view of throwing the atomic bomb over Hiroshima and Nagasaki is the following. Japanese people said that was a terrible military action that caused too much pain. suffering, and destruction to Japanese civilians. Japan considered was an unnecessary action on the part of President Harry Truman. Many Japanese think that the action had to be punished as a war crime. They say that strong military action such as conventional bombing over Japanese strategic places and a series of blockades could be more than enough to force Japan to surrender easily.

Of course, this is an issue that had caused so much debate not only in Japan but in the United States as well.

_____ is the name used to refer to the era of legalized segregation in the United States.

African-American History: Select the correct answer from the choices provided.
A.
Affirmative action
B.
Antebellum
C.
Jim Crow
D.
Reconstruction

Answers

Answer:

C

Explanation:

It's just C ok

Answer:

Women and Minorities: QuizQuestion #9

_____ is the name used to refer to the era of legalized segregation in the United States.  _____________________________________________

Answers:

A. Affirmative action

B. Antebellum

This answer →→→C. Jim Crow←←← is 100% correct

D. Reconstruction

Explanation:

I took the test and this is 100%

1. Rural African tribesmen that hunt wild game to provide food for the family and the tribe.

This would be a component of what type of economy?

Answers

Answer:I believe coastal

Explanation:

Did the US contain communism with the Vietnam war?

Answers

Answer:

no

Explanation:

no we lost the war

Answer:

no

Explanation:

The policy of containment had failed politically. Not only had the USA failed to stop Vietnam falling to communism, but their actions in the neighbouring countries of Laos and Cambodia had helped to bring communist governments to power there too. ... The policy of containment had failed in the propaganda war.

What is the job of a ground intelligence officer?

Answers

Answer:

Ground intelligence officers serve as staff officers and commanders in the operating forces and are responsible for analyzing intelligence and planning, deployment and tactical employment of ground surveillance and reconnaissance units. The Ground Intelligence Officer can be a Recon Marine after their training is done.

Explanation:

Hope this helps!

WILL GIVE BRAINLIST! LOTS OF POINTS!!!!

Read the passage.

I only wish I had words to serve me to blame those who are fain to extol the worship of men more than that of the sun; for in the whole universe there is nowhere to be seen a body of greater magnitude and power than the sun. Its light gives light to all the celestial bodies which are distributed throughout the universe; and from it descends all vital force, for the heat that is in living beings comes from the soul [vital spark]; and there is no other [center] of heat and light in the universe.

–"In Praise of the Sun”
Leonardo da Vinci

What is da Vinci’s strongest argument in support of his main idea?

-saying the sun is the center of the universe
-talking about the sun being the most powerful star
-explaining why the sun is a necessary part of human life
-using an emotional argument to connect the sun and the soul

Answers

Answer:

c

Explanation:

Answer:

C

Explanation:

I know that this is probibly too late sorry.  :(

6th grade social studies help me pleasee

Answers

Answer:

Correct answer is A. Division of power between the state governments and the national government

Answer: A

Explanation Federalism is the principle of the constitution which splits power between a national or federal government and the local governments. This principle is important because the Articles of Confederation failed because there was no strong central government. Without a strong central government countries are weak and vulnerable.

(GIVING BRAINLIEST!!!!!)

The Bill of Rights states that any powers not outlined in the Constitution as belonging specifically to the national government belong to the states and to the people. What is this an example of?

A) Fear of unfair trials
B) The limited power of the national government
C) Freedom to protest peacefully
D) The freedom of the national government to take more power

Answers

Answer:

freedom to protest peacefully

Answer:

c

Explanation:

What kinds of tissues are involved when this girl uses the head tickler? Explain your answer in 3-5 sentences. PLZ HELP

Answers

She’s pushing out a baby duhhh

Write three words or phrases to describe each term?

Answers

I think is uh..I think is uh carrot

. The source above describes the philosophy of the Renaissance called..
A. Predestination
B. Natural Law
C. Neo-Confucianism
D. Humanism

Answers

Answer:

Explanation:

14. Before a territory can become a state, A. Congress must pass an enabling act. B. Congress must petition the president for statehood. C. it must petition the president for statehood. D. it must receive two-thirds of the Senate votes.​

Answers

Answer:

D

Explanation:

xdjcjfjsjxksiskxkjcjsxij

How are physical geologists different from historical geologists?
Report an Error
question 4 of 5
Physical geologists study oceans, while historical
geologists study the timing of past events.
O Physical geologists study the universe, while
historical geologists study the composition and
structure of the Earth.
Physical geologists study the timing of past events,
while historical geologists study oceans.
Physical geologists study the composition and
structure of the Earth, while historical geologists
study the timing of past events.
Physical geologists study weather, while historical
geologists predict earthquakes.
Next

Answers

Answer:

Physical geologists study the composition and structure of the Earth, while historical geologist study the timing of past events.

which of the confederate states were west of the mississippi river​

Answers

The Trans-Mississippi Theater of the American Civil War consists of the major military operations west of the Mississippi River. The area is often thought of as excluding the states and territories bordering the Pacific Ocean, which formed the Pacific Coast Theater of the American Civil War (1861–1865).


Map of Trans-Mississippi Theater of the American Civil War, featuring only the major battles
The campaign classification established by the National Park Service of the U.S. Department of the Interior[1] is more fine-grained than the one used in this article. Some minor NPS campaigns have been omitted and some have been combined into larger categories. Only a few of the 75 major battles the NPS classifies for this theater are described. Boxed text in the right margin show the NPS campaigns associated with each section.

Activity in this theater in 1861 was dominated largely by the dispute over the status of the border state of Missouri. The Missouri State Guard, allied with the Confederacy, won important victories at the Battle of Wilson's Creek and the First Battle of Lexington. However, they were driven back at the First Battle of Springfield. A Union army under Samuel Ryan Curtis defeated the Confederate forces at the Battle of Pea Ridge in northwest Arkansas in March 1862, solidifying Union control over most of Missouri. The areas of Missouri, Kansas, and the Indian Territory (modern-day Oklahoma) were marked by extensive guerrilla activity throughout the rest of the war, the most well-known incident being the infamous Lawrence massacre in the Unionist town of Lawrence, Kansas of August 1863.
hope It Helps U
Please Mark as Brainliest
Texas, Louisiana, Arkansas, and Missouri.

information regarding the satellites sent by India for educational and communicational purposes​

Answers

Answer:

EDUSAT is the first Indian satellite built exclusively to serve the educational sector. It is mainly intended to meet the demand for an interactive satellite-based distance education system for the country. EDUSAT was successfully launched into from the Satish Dhawan Space Centre in Sriharikota

please help asap!!!!!​

Answers

Answer:

B and D

Explanation:

I think please dont kill me if im wrong :(

Answer:

3_ its answer C since peer group means a group of friends and marble game is not a voluntary thing its only for fun

4_ answer D

doing love is not bad but u must know it's importance , u must be capable to understand each other, u much be capable to do love by heart then only it becomes natural which is scarce as people see physical appearance only​

Answers

Answer:

yes correct

Explanation:

i too need like that

Explanation:

yes I do like, because she is my back bone.

Other Questions
Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks. hey can someone give me an idea how I should do a rough draft on a computer What is the range of the function y=-2/3x-10given a domain of{-9,-3,0,3,9} Read this sentence from paragraph 2 of "Puzzle Solved"Solving this thing is as easy asslaying Medusa!Why does Anya compare the cryptogram to slaying Medusa?A It is difficult to conquerOB. It is based on mythologyoc. It is not what it seems.OD. It is hard to look at.