Suppose that we would like to determine the proportion of U.S. citizens who have brown hair. To estimate this, we randomly select 100 people and we find that 63 of them have brown hair. Construct a 95% confidence interval for the proportion of people with brown hair in the U.S.

Answers

Answer 1

we are 95% confident that the true proportion of people with brown hair in the U.S. falls between 0.532 and 0.728.

To construct a 95% confidence interval for the proportion of people with brown hair in the U.S., we can use the following formula:

[tex]Confidence Interval = p± z \sqrt{\frac{p(1-p)}{n} }[/tex]


where p is the proportion of people with brown hair in our sample, z is the critical value for a 95% confidence level (which is 1.96), and n is the sample size.

In this case, our sample proportion is , and our sample size is 100. Plugging these values into the formula, we get:

[tex]Confidence Interval = 0.63  ± 1.96\sqrt{\frac{0.63(1-0.63)}{100} }[/tex]

Simplifying the expression inside the square root, we get:

[tex]Confidence Interval= 0.63 ± 0.098[/tex]

Therefore, the 95% confidence interval for the proportion of people with brown hair in the U.S. is:

[tex]\frac{63}{100}  = 0.63[/tex](0.532, 0.728)

This means that we are 95% confident that the true proportion of people with brown hair in the U.S. falls between 0.532 and 0.728.

To know more about "Confidence Interval" refer here:

https://brainly.com/question/29680703#

#SPJ11


Related Questions

Question 2(Multiple Choice Worth 2 points)
(Appropriate Measures MC)

The box plot represents the number of tickets sold for a school dance.

A horizontal line labeled Number of Tickets sold that starts at 8, with tick marks every one unit up to 30. The graph is titled Tickets Sold for A Dance. The box extends from 17 to 21 on the number line. A line in the box is at 19. The lines outside the box end at 10 and 27.

Which of the following is the appropriate measure of center for the data, and what is its value?

The mean is the best measure of center, and it equals 19.
The median is the best measure of center, and it equals 4.
The median is the best measure of center, and it equals 19.
The mean is the best measure of center, and it equals 4.

Answers

For the given problem, The correct answer will be option 3: The median is the best measure of center, and it equals 19.

What is a box plot?

A box plot,also known as a box-and-whisker plot, is used for graphical representation of summary statistics from a data set. It helps by providing a visual representation of a data set's central tendency, dispersion, and skewness, making it straightforward to identify important data aspects.

As box ranges from (17 to 21), the interquartile range (IQR) is [tex](21 - 17 = 4)[/tex].

The median is represented by the line inside the box, which is at 19. This shows that 50% of whole data is less than 19 and 50% of it is greater than 19.

Outside the box, the lines finish at 10 and 27, representing the lower and upper whiskers, respectively. Data range is represented by these lines, where lower whisker extends to a minimum of 10 and the higher whisker reaching to a maximum upto 27.

Since the median represents the middle value of the data when sorted in ascending order, and it is not influenced by outliers or extreme values, it is considered a robust measure of center. In this case, the median is 19, as it is the value at the center of the data according to the box plot.

Learn more about median here:

https://brainly.com/question/28060453

#SPJ1

Solve the simultaneous equation
x² + y² = 1
5x+12y +13=0

Answers

The two solutions to the system of equations are (x,y) = (7/5,-3) and (x,y) = (144/65,-12/13).

What is quadratic equation?

it's a second-degree quadratic equation which is an algebraic equation in x.

We can use substitution to solve this system of equations.

First, we solve the second equation for one of the variables, say x:

5x + 12y + 13 = 0

5x = -12y - 13

x = (-12/5)y - (13/5)

Next, we substitute this expression for x into the first equation:

x² + y² = 1

[(-12/5)y - (13/5)]² + y² = 1

Expanding the square and simplifying, we get:

y² + [(144/25)y² + (312/25)y + (169/25)] + y² = 1

(26/5)y² + (312/25)y + (144/25) = 0

Multiplying both sides by 25 to eliminate the fractions:

26y² + 312y + 144 = 0

Dividing by 4 to simplify:

6.5y² + 78y + 36 = 0

Using the quadratic formula:

y = (-b ± sqrt(b² - 4ac)) / 2a

where a = 6.5, b = 78, and c = 36.

Plugging in these values:

y = (-78 ± sqrt(78² - 4(6.5)(36))) / 2(6.5)

y = (-78 ± sqrt(4761)) / 13

y = (-78 ± 69) / 13

y = -3 or -12/13

If y = -3, then substituting into the equation for x gives:

x = (-12/5)(-3) - (13/5) = 7/5

So one solution is (x,y) = (7/5,-3).

If y = -12/13, then substituting into the equation for x gives:

x = (-12/5)(-12/13) - (13/5) = 144/65

So another solution is (x,y) = (144/65,-12/13).

Therefore, the two solutions to the system of equations are (x,y) = (7/5,-3) and (x,y) = (144/65,-12/13).

To learn more about quadratic equation from the given link:

brainly.com/question/30098550

#SPJ1

what is the probability that all 6 workers are selected from the same shift? again, assume the employees are selected sequentially and not all at once. round your answer to four decimal places. save your answer as p allsame.

Answers

For a production company of total 24 workers, who works in different shifts. The probability that all 6 workers are selected from the same shift is equals to the 0.0019.

We have a company with faculty working in different shifts. Total number of workers in company = 10 + 8 + 6 = 24

Number of workers work in day shift = 10

Number of workers work in swing shift= 8

Number of workers work in graveyard shift = 6

Now, 6 workers are randomly selected from among 24. That is any of group of 6 can be selected. Number of possible ways to select 6 out of 24 = ²⁴C₆=134,596.

Number of ways to select a group of 6 workers from morning shift = ¹⁰C₆ = 210

Number of ways to select a group of 6 workers from swing shift = ⁸C₆= 56

Number of ways to select a group of 6 workers from graveyard shift = ⁶C₆ = 1

Now, probability to select the group of 6 from morning shift = [tex]\frac{210}{134596}[/tex]

Probability to select the group from morning shift = [tex]\frac{56}{134596}[/tex]

Probability to select the group from graveyard shift=[tex]\frac{1}{134596}[/tex].

Total probability for selecting a group of 6 workers from same shift [tex]= \frac{210}{134596} + \frac{56}{134596} + \frac{1}{134596} [/tex]

[tex]= \frac{267}{134596}[/tex]

= 0.00198

Hence, required probability is 0.0019.

For more information about probability, refer:

https://brainly.com/question/25870256

#SPJ4

Complete question:

a production company factory 10 workers on day shift , 8 workers on swing shift and 6 workers on graveyard shift. A quality control team select 6 workers for in depth interviews.. Suppose the selection made in such a way that any particular group of 6 workers has same chance to selecting as does any other group( drops 6 slips without replacement from among 24 )

what is the probability that all 6 workers are selected from the same shift, again, assume the employees are selected sequentially and not all at once. round your answer to four decimal places. save your answer as p all same.

what is the value of x, in units?

Answers

Answer: 12 units

Step-by-step explanation: see both shapes are the same just one is flipped and its small meaning the first shape without numbers is only double of the shape with numbers so you answer would be 12 units

small shape x 2 gives all your answers to the big shape

TOO

EASY

BYE

PLEASE HELP ME THIS IS DUE ANY MINUTE

Answers

Answer: (7, 1)

Step-by-step explanation:

To find the coordinates of Q' which is the image of point Q(0, 6) under the translation (x, y) → (x + 7, y − 5), we can apply the translation to the coordinates of Q as follows:

x-coordinate of Q' = x-coordinate of Q + 7

= 0 + 7

= 7

y-coordinate of Q' = y-coordinate of Q - 5

= 6 - 5

= 1

Therefore, the coordinates of Q' are (7, 1).

since we are comparing more than 2 groups, we will use anova to test whether the data provide evidence that sat score is related to study strategy. one of the conditions that allows us to use anova safely is that of equal (population) standard deviations. can we assume that this condition is met in this case?

Answers

Answer: To determine whether the condition of equal standard deviations is met in this case, we can perform a quick check by comparing the sample standard deviations of each group. If the sample standard deviations are roughly equal, then we can assume that the condition of equal standard deviations is met.

Alternatively, we can use Levene's test for equality of variances, which tests the null hypothesis that the population variances are equal across all groups. If the p-value of the test is greater than the significance level (usually 0.05), then we can assume that the condition of equal standard deviations is met.

Without the data or the sample standard deviations, it is not possible to determine whether the condition of equal standard deviations is met in this case.

Step-by-step explanation:

can you please help me with this?

Answers

The number of packs of hot dogs that Aldo bought were 6 packs. The number of packs of buns were 5 packs and the number of hot dogs were 60 hot dogs.

How to find the number of packs ?

Aldo bought the same number of hot dogs as buns. To find the least number of hot dogs and buns for which this is possible, we need to find the least common multiple (LCM) of the pack sizes (10 for hot dogs and 12 for buns).

Packs of hot dogs:

LCM / hot dogs per pack = 60 / 10 = 6 packs

Packs of buns:

LCM / buns per pack = 60 / 12 = 5 packs

Aldo bought 6 packs of hot dogs and 5 packs of buns. The total number of hot dogs he bought is:

6 packs x 10 hot dogs per pack = 60 hot dogs.

Find out more on packs at https://brainly.com/question/17400046

#SPJ1

the average math sat score for incoming freshman at a particular college is 535 with a standard deviation of 60. the coefficient of variation for sat scores at this school is

Answers

The coefficient of variation for SAT scores at this school is 11.21%. This means that the standard deviation of the SAT scores is about 11.21% of the mean score.

The coefficient of variation (CV) is a measure of relative variability, defined as the ratio of the standard deviation to the mean of a dataset. It is expressed as a percentage and provides a way to compare the variability of datasets with different means.

To calculate the CV for SAT scores at this particular college, we first need to calculate the standard deviation of the dataset. We are given that the average SAT score for incoming freshmen is 535 with a standard deviation of 60. Therefore, the standard deviation (s) is 60.

Next, we need to calculate the mean of the dataset. We are given that the mean (μ) is 535.

The coefficient of variation is then given by:

CV = (s / μ) x 100%

Substituting the values, we get:CV = (60 / 535) x 100%

= 0.1121 x 100%

= 11.21%

Therefore, the coefficient of variation for SAT scores at this school is 11.21%. This means that the standard deviation of the SAT scores is about 11.21% of the mean score. This information can be useful in comparing the variability of SAT scores between different colleges, even if their mean scores are different.

Learn more about coefficient of variation (CV)

https://brainly.com/question/29252060

#SPJ4

The coefficient of variation for SAT scores at this school is approximately 11.21%.

The coefficient of variation for SAT scores at this school can be calculated using the following formula:

Coefficient of Variation = (Standard Deviation / Mean) x 100

Given the average math SAT score for incoming freshmen at this particular college is 535 and the standard deviation is

60, we can plug these values into the formula:

Coefficient of Variation = (60 / 535) x 100

Now, let's perform the calculations:

Coefficient of Variation ≈ 11.21 %

So, the coefficient of variation for SAT scores at this school is approximately 11.21%.

for such more question on coefficient of variation

https://brainly.com/question/19616808

#SPJ11

Find ß in degrees. B 12 7 [?]° Round to the nearest hundredth.​

Answers

Answer:

Set your calculator to degree mode.

[tex] \tan( \beta ) = \frac{7}{12} [/tex]

[tex] \beta = {tan}^{ - 1} \frac{7}{12} = 30.26 \: degrees[/tex]

Seraphina is driving two hours to visit her family. For the first hour, she traveled at a speed of 57 miles per hour. Then, in the second hour, she traveled at a speed of 73 miles per hour. What is the percentage increase of Seraphina's speed? If necessary, round to the nearest tenth of a percent.

Answers

The percentage increase of Seraphina's speed would be = 12.3%

How to calculate the percentage increase in speed of Seraphina?

The speed she travelled in the first hour = 57miles/hr

The speed she travelled in the second hour = 73miles/jr

The increase in speed = 73-57 = 16

Therefore the percentage increase;

= 16/130×100/1

= 1600/130

= 12.3%

Learn more about percentage here:

https://brainly.com/question/24339661

#SPJ1

To determine the sample size needed to estimate a parameter, you must know the margin of error. (True or False)

Answers

The margin of error is an important factor in determining the sample size needed to estimate a parameter, it is not the only factor - False.

Other factors that need to be considered include the level of confidence desired, the variability of the population being sampled, and the size of the population.

The margin of error is the amount of error that is acceptable in the estimate of the parameter. The smaller the margin of error desired, the larger the sample size needed.

A higher level of confidence requires a larger sample size, as there is less room for error in the estimate. The variability of the population being sampled also plays a role in determining the sample size needed.

Finally, the size of the population being sampled also affects the sample size needed.

A smaller population requires a smaller sample size, while a larger population requires a larger sample size to ensure a representative sample.

In summary, while the margin of error is an important factor in determining the sample size needed to estimate a parameter, it is not the only factor.

Other factors that need to be considered include the level of confidence desired, the variability of the population being sampled, and the size of the population.

For similar question on margin of error:

https://brainly.com/question/13679908

#SPJ11

Use the diagram to find the measure of KM.

.

Answers

Therefore, the measure of arc KM is 160 degrees.

What is arc?

In geometry, an arc is a portion of the circumference of a circle or any other curved shape. It is defined by two endpoints and all the points on the curve between those endpoints. The measure of an arc is typically given in degrees, and it is equal to the measure of the central angle that subtends the arc.

Here,

Since P is the center of the circle, we know that arc KM is twice the measure of angle KPM. Therefore, we need to find angle KPM first.

We know that angle KPL is 100 degrees, so angle KPM is the supplement of angle KPL, which is:

180 degrees - 100 degrees = 80 degrees

Similarly, we know that angle NPM is 120 degrees, so angle NPL is the supplement of angle NPM, which is:

180 degrees - 120 degrees = 60 degrees

Since angle KPL and angle NPL are vertical angles, they are congruent. Therefore, angle KPL has a measure of 60 degrees.

Now we can find the measure of arc KM:

arc KM = 2 * angle KPM

= 2 * 80 degrees

= 160 degrees

To know more about arc,

https://brainly.com/question/20294211

#SPJ1

You have 10 grades in your math class. After ordering them from least to greatest, this is the data set: {80, 82, 82, 83, 85, 88, 92, 95, 95, 96}. Which statement is true about the mode?

The mode is 95.

The mode is 82.

There are two modes: 82 and 95.

There is no mode

Answers

Answer:

82 and 95

Step-by-step explanation:

Most repeated

Using the Standard Normal Table, what is the area to the left of z < -2.34?

Answers

The Standard Normal Table is a tool that is used to calculate probabilities associated with the standard normal distribution.

When using the Standard Normal Table, we can find the area to the left of z < -2.34 by first locating the value -2.3 in the left-hand column of the table and the value -0.04 in the top row of the table.

Then, we find the intersection of the row and column to locate the corresponding value of 0.0099. This value represents the area to the left of -2.3 on the standard normal distribution.

To find the area to the left of -2.34, we need to adjust the value by subtracting the area to the left of -2.34 from the area to the left of -2.3.

The standard normal distribution is symmetric around the mean of 0. It means the area to the right of -2.3 is the same as the area to the left of 2.3.

Therefore, the area to the left of z < -2.34 is the area to the left of -2.3 (0.0099) minus the area between -2.34 and -2.3 (0.0040), which equals 0.0059. So, the area to the left of z < -2.34 is 0.0059.

For similar question on Standard Normal Table

https://brainly.com/question/29291264

#SPJ11

True or False: For a given mass of rising air, the dry adiabatic rate will always be higher than the wet adiabatic rate.

Answers

Answer:

true

Step-by-step explanation:

because there's less humidity

if the diameter of a circle is 4x+12 then find the area?


please solve this question...this question is based on "multiplying binomials by binomials" ​

Answers

since the formula for the area of a circle squares the radius, the area of the larger circle is always 4 or 22 multiple the tiny square

SHARKS The average length of a whale shark is 24.821 feet long. The average whale shark is 13.319 feet longer than the average length of a great hammerhead shark (x)? What is the average length of a great hammerhead shark?

Answers

Answer:

11.502

Step-by-step explanation:

Solve the equation. Round to the nearest tenth if necessary. x^2=36​

Answers

Answer:

x = 6

Step-by-step explanation:

Solve for x:

[tex]x^2=36[/tex]

Take the square root of 36

[tex]x=6[/tex]

A box contains 3 pens, 2 markers, and 1 highlighter. Tara selects one idem randomly and does not return it to the box. She then selects a second idem randomly. What is the probability that Tara selects 1 pen and then 1 marker? A. ) 5/36 B. ) 6/30 C. ) 6/36 D. ) 27/30​

Answers

The probability that Tara selects 1 pen and then 1 marker is 6/30 (option b).

To solve this problem, we need to first find the total number of ways that Tara can select two items from the box without replacement.

In this case, we have n = 6 (3 pens, 2 markers, and 1 highlighter) and r = 2. Therefore, the total number of ways that Tara can select two items is:

6C2 = 6! / 2! (6 - 2)! = 15

Next, we need to find the number of ways that Tara can select a pen first and then a marker.

Therefore, the number of ways to select a pen first is 3, and the number of ways to select a marker second is 2. The total number of ways to select a pen first and then a marker is:

3 x 2 = 6

Finally, we can find the probability of selecting a pen first and then a marker by dividing the number of ways to select a pen first and then a marker by the total number of ways to select two items:

6 / 15 = 2 / 5

Therefore, the correct answer is option B) 6/30, which can be simplified to 2/5.

To know more about probability here

https://brainly.com/question/11234923

#SPJ4

Write a matrix that when multiplied by any point [x/y] would have the effect of rotating the point 90 degrees counterclockwise. Also determine the algebraic effect of performing the transformation on the point A.

Answers

The result of rotating the point [-5, 2] by 90 degrees counterclockwise is the point [2, -5].

Define rotation

Rotation is a transformation in geometry that involves turning or spinning an object around a fixed point called the center of rotation. The center of rotation remains stationary while all the points of the object move along circular paths, at the same angle and distance from the center.

To rotate a point [x/y] counterclockwise by 90 degrees, we can use a 2x2 matrix of the form:

[ 0 -1 ]

[ 1 0 ]

To multiply this matrix by a point [x/y], we can use the following matrix multiplication:

[ 0 -1 ] [ x ] [ -y ]

[ 1 0 ] [ y ] = [ x ]

So, if we have a point [x/y] and we want to rotate it 90 degrees counterclockwise, we can multiply it by the matrix [ 0 -1 ; 1 0 ] to get the new point [-y/x].

To rotate a point 90 degrees counterclockwise using a matrix, we need to represent the point as a column matrix and then multiply it by the 2x2 rotation matrix.

Assuming that the point is [x, y] = [-5, 2], we can represent it as a column matrix:

| -5 |

| 2 |

To rotate the point counterclockwise by 90 degrees, we can use the following 2x2 rotation matrix:

| 0 -1 |

| 1 0 |

Multiplying the rotation matrix by the column matrix representing the point gives:

| 0 -1 | | -5 | | 2 |

| 1 0 | ×| 2 | = | -5 |

So the result of rotating the point [-5, 2] by 90 degrees counterclockwise is the point [2, -5].

To know more about transformation, visit:

https://brainly.com/question/13801312

#SPJ1

5x+4y=-3+y=2x-4 solve for x and y

Answers

The system of equations are solved and x = 1 and y = -2

Given data ,

Let the system of equations be A and B

where 5x + 4y = -3

y = 2x - 4

Substituting the value of y in equation (1) , we get

5x + 4 ( 2x - 4 ) = -3

On simplifying the equation , we get

5x + 8x - 16 = -3

Adding 16 on both sides , we get

13x = 13

Divide by 13 on both sides , we get

x = 1

Now , when x = 1

y = -2

Hence , the equations are solved

To learn more about equations click :

https://brainly.com/question/19297665

#SPJ1

Graph the line with the equaation y=-2/5x-2

Answers

The graph of the linear equation is on the image at the end.,

How to graph the linear equation?

To graph a line, we need to find two points on the line and then connect them with a line.

Evaluating in x = 0 we will get.

y = (-2/5)*0 - 2 = -2

evaluating in x = 5

y = (-2/5)*5 - 2 = -4

Then we have the points (0, -2) and (5, -4)

And the graph of the linear equation can be seen in the image at the end.

Learn more about linear equations at:

https://brainly.com/question/1884491

#SPJ1

2. The graph of AEFG is shown. Graph the
image of AEFG after a translation of 3 units
left and 1 unit down. Write the coordinates of
the image. (Example 1)
YA E
F
O
G
X

Answers

Thus, the new coordinates of the image of ΔEFG after the given translations is found as:  E'(-2, 3), F'(-4, 0), G'(-1, -2).

Explain about the translation:

A translation is represented as a column vector. Using a column vector, the translation is divided into:

The extent to which a shape travels horizontally (left or right).Size of a shape's vertical displacement (up or down).

Given that-

ΔEFG after a translation of 3 units left and 1 unit down.Coordinates of ΔEFG: E(1,4) , F(-1 , 1), G(2, -1)

Now,

translation of 3 units left and 1 unit down - subtract 3 from the x coordinates and 1 from the y coordinates.

E(1,4)  = E' (1 - 3, 4 - 1) = E'(-2, 3)

F(-1 , 1) = F'(-1 - 3, 1 - 1) = F'(-4, 0)

G(2, -1) = G'(2 - 3, -1- 1) = G'(-1, -2)

Thus, the new coordinates of the image of ΔEFG after the given translations is found as:  E'(-2, 3), F'(-4, 0), G'(-1, -2).

Know more about the translation

https://brainly.com/question/12861087

#SPJ1

I need some help pretty please

Answers

Answer:

y - 2 = 2(x + 3)

Step-by-step explanation:

the equation of a line in point- slope form is

y = b = m(x - a)

where m is the slope and (a, b ) a point on the line

calculate m using the slope formula

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (- 3, 2 ) and (x₂, y₂ ) = (2, 12 )

m = [tex]\frac{12-2}{2-(-3)}[/tex] = [tex]\frac{10}{2+3}[/tex] = [tex]\frac{10}{5}[/tex] = 2

using (a, b ) = (- 3, 2 ) , then

y - 2 = 2(x - (- 3) ) , that is

y - 2 = 2(x + 3)

1.6 Give a reason why the bank is legible to charge service fees?​

Answers

Answer:

Banks are eligible to charge service fees to cover the costs of providing and maintaining various banking services such as account maintenance, ATM access, online banking, and customer support. These fees help banks to generate revenue and continue to offer their services to customers. The specific fees and their amounts can vary depending on the bank and the type of account or service being used.

Listen to the following recommendations and answer the question.

What is the first recommendation?

O Buy more than one ticket at a time.

O Buy tickets in a travel agency.

O Buy a round-trip ticket.

O Buy plane tickets way in advance

Answers

The first recommendation among the given options is "Buy more than one ticket at a time".

This recommendation suggests that purchasing multiple tickets in a single transaction can result in cost savings. Many airlines offer discounted fares for group bookings, which means buying multiple tickets at once can save money compared to buying them individually.

Buying tickets in bulk not only saves money, but it also provides a level of flexibility in terms of travel plans. For instance, if a group of travelers plan to visit a particular destination together, they can book their tickets together and have a better chance of securing seats on the same flight. Additionally, in case there are changes in the travel plans, such as the need to reschedule or cancel, group bookings provide more flexibility in terms of making changes or requesting refunds.

Overall, buying more than one ticket at a time can be a wise decision, especially if one is traveling with a group or planning multiple trips in the near future. By doing so, one can save money and have more flexibility in terms of travel plans, making the overall travel experience smoother and more enjoyable.

To learn more about ticket here:

https://brainly.com/question/22233867

#SPJ4

If one zero of the polynomial (3
2 + 8 + ) is the reciprocal of the
other, then find the value of k

Answers

If one zero of the polynomial 3x^2 + 8x + k is  the reciprocal of the

other, then k = 3 by applying product of roots formula.

The quadratic polynomial is 3x^2 + 8x + k.

Let the roots of  3x^2 + 8x + k be m and n where m and n are reciprocal of each other. Therefore, n = 1/m

Thus, the product of roots is = m*n = m*(1/m) = 1 ____(1)

The general equation of a quadratic equation can be written as,

ax^2 + bx + c = 0

where a and b are coefficients of x^2 and x respectively and c is a constant term.

From product of roots formula we know that,

Product of roots =constant term/ coefficient of x^2 = c/a

Therefore, for polynomial is 3x^2 + 8x + k we get,

Product of roots = k/3 ____(2)

From equating equation (1) and (2) we get,

k/3 = 1

⇒ k = 3

To know more about product of roots here

https://brainly.com/question/10719430

#SPJ4

The given question is incomplete, the complete question is

"If one zero of the polynomial 3x^2+8x+k is the reciprocal of the other, then find the value of k."

Expense
Gas
Insurance
Oil
Registration
Depreciation
Yearly cost
or rate
A. $1.11 per mile
C. $0.25 per mile
$550.00
$400.00
$90.00
$100.00
20%
What is the cost per
mile over the course of
a year for a $24,000 car
that depreciates 20%,
with costs shown in the
table, and that has
been driven for 10,000
miles?
B. $0.59 per mile
D. $4.91 per mile

Answers

the cost per mile over the course of a year for a $24,000 car that depreciates 20%, with costs shown in the table, and that has been driven for 10,000 miles is $0.59 per mile. Answer B is correct.

Obtaining the cost

To calculate the cost per mile, we need to add up all the expenses for the car and divide by the total miles driven.

First, we need to calculate the total depreciation for the car:

Depreciation = 20% * $24,000 = $4,800

Next, we can calculate the total expenses for the car:

Total expenses = Gas + Insurance + Oil + Registration + Depreciation

Total expenses = $550 + $400 + $90 + $100 + $4,800

Total expenses = $5,940

Finally, we can calculate the cost per mile:

Cost per mile = Total expenses / Miles driven

Cost per mile = $5,940 / 10,000

Cost per mile = $0.594 or $0.59 (rounded to the nearest cent)

Therefore, the cost per mile over the course of a year for a $24,000 car that depreciates 20%, with costs shown in the table, and that has been driven for 10,000 miles is $0.59 per mile. Answer B is correct.

Note: Option D is not a possible answer because the cost per mile cannot be greater than the total expenses divided by the miles driven, which in this case is $0.594.

Learn more on cost here https://brainly.com/question/25109150

a. This dot plot shows the ages of students in a swimming class. How many students
are in the class?
Based on the dot plot, do you agree with each of the following statements? Explain
your reasoning.
b. The class is an adult swimming class.
C. Half of the students are between 2 and 3 years old.

Answers

a). There are a total of 10 students in the class, according to the dot plot.

b). The students' ages, which vary from 1 to 5, indicate that this is not an adult swimming lesson.

c). Thus, just 20% (2/10) of the students are toddlers or preschoolers.

What is number?

Numbers are mathematical units of measurement and labelling. It is an ethereal idea that can stand in for many different material quantities, including time, money, and distance. Real numbers, complex numbers, and even irrational numbers can all be considered numbers in mathematics.

Numbers are frequently employed in mathematical equations to express relationships and to represent data. They are also employed in the development of models, patterns, and data analysis.

a). There are a total of 10 students in the class, according to the dot plot.

b). The programme is a swimming lesson for adults.

No, it doesn't seem to be an adult swimming lesson based on the dot plot. The students' ages, which vary from 1 to 5, indicate that this is not an adult swimming lesson.

c). The majority of the students are between the ages of 2 and 3.

No, it doesn't seem like half of the students are between the ages of 2 and 3, according to the dot plot. There are two students who are two years old, one who is three, two who are four, and five who are five. Thus, just 20% (2/10) of the students are toddlers or preschoolers.

To know more about number click-

brainly.com/question/24644930

#SPJ1

The diameter of a circle is 170 inches. The circle has two chords of length 26 inches. What is the distance from each chord to the center of the circle?

Answers

the distance from each chord to the center of the circle is 85 inches.

what is  chord ?

In geometry, a chord is a line segment that connects two points on the circumference of a circle. It is the straight line that intersects a circle at two points. In other words, a chord is a line segment that lies entirely inside the circle and connects two points on the circle.

In the given question,

If we draw a diagram of the circle with diameter 170 inches, we can see that the chords of length 26 inches divide the circle into two regions. We are interested in finding the distance from each chord to the center of the circle.

To solve this problem, we can use the following formula:

distance from chord to center = 1/2 * √(4r² - c²)

where r is the radius of the circle and c is the length of the chord.

First, we need to find the radius of the circle. The radius is half of the diameter, so:

r = 1/2 * diameter = 1/2 * 170 = 85 inches

Next, we can use the formula above to find the distance from each chord to the center of the circle. Plugging in the values we have:

distance from chord to center = 1/2 * √(4r² - c²)

distance from chord to center = 1/2 * √(4(85)² - 26²)

distance from chord to center = 1/2 * √(28,900)

distance from chord to center = 1/2 * 170

distance from chord to center = 85

Therefore, the distance from each chord to the center of the circle is 85 inches.

To know more about chord, visit:

https://brainly.com/question/8944240

#SPJ1

Other Questions
You push with a steady force of 19 N on a 46-kg desk fitted with casters (wheels that swivel) on its four feet.How long does it take you to move the desk 5.1 m across a warehouse floor? Question 34Perhaps the most important determinant of the cancer-causing potential of asbestos is:a. the type of asbestos mineral to which one is exposedb. the physical properties of asbestosc. the chemical properties of asbestosd. the size of the asbestos fibers to which one is exposed please translate to genetic code:GACCAAAUGGUAGCUAACUUUUGCAAUUUUAGGUCAAGGUA Percussion of the costovertebral angle that results in the reproduction of symptoms:a. Signifies radiculitisb. Signifies pseudorenal painc. Has no significanced. Requires medical referral PLEASE HELP ASAPThe table shows values for functions f(x) and g(x).x f(x) g(x)1 7 73 10 35 0 57 5 09 5 511 7 11Which answers are solutions to the equation f(x)=g(x)?Select each correct answer.Responses135910 A key component of DSS is the ability to visualize the results. For example, it is important for executives to visualize the results of modifying assumptions.Select one:TrueFalse Critical-Thinking Question A: You are President Roosevelt's chief advisor on nationalsecurity issues. What would you advise the president to do? Why?A. Intern-place in armed camps-all Germans, Italians, and Japanese citizens andnoncitizens, approximately one million people.B. Intern only those Germans, Italians, and Japanese that appear to be disloyal.C. Place all Japanese citizens and noncitizens, regardless of age, gender, or place of birth, ininternment camps well away from strategic coastal areas.D. Establish zones around military installations and strategic areas and require an entry pass.E. Deal with Germans, Italians, and Japanese the same way as other U.S. citizens-on acase-by-case basis. Proven enemy collaborators should be sent to jail or interned. Chase is not an effective speaker because he uses very informal language.O Chase is not an effective speaker because he is notconfident about his idea.O Chase is a very effective speaker because he comesprepared to share. Chase is a very effective speaker because he communicates non-verbally. In which event of a muscle cell action potential do potassium channels open and K+ ions rush out of the cell? plpa a heteroecious rust is one that group of answer choices has five spore stages in its life cycle has fewer than five spore stages in its life cycle completes its life cycle on a single plant host species completes its life cycle on two distinct plant host species none of the others All of the following are tools and techniques used in the Control Procurements process except: 50 points pls help me What does Mr. Link Deas mean when he says, "Don't know why you touched it in the first place...You've got everything to lose from this, Atticus. I mean everything"? In 1947, Wassily Leontief tested the H-O theory for the United States and to his surprise found that the US exported more labor- intensive goods, rather than capital goods. How does your textbook explain this seeming contradiction? Any know how to number these I keep getting them wrong (354-10) The use of nonmetallic conduit with conductors shall be permitted for direct burial underground installation; in cinder fill; or encased or embedded in concrete.(True/False) Portable signs in wet locations shall have ___________.600.12(2) During Concept testing it is important to present a brief written description to _____ to obtain their reactions to the ideas presented The function f(x)=0.75x+4.59 represents the cost of shipping packages based on a flat rate and the weight of each package, x , in pounds, where x>0 . What does 4.59 represent in the function f(x) ? PLEASE HELP I have no idea how to do this.. our teacher hasnt been here all week.. and I have no clue what this is.. solve for the value of V (9v+3) 60