the neo-freudians moved away from many of freud's ideas because they believed that: the neo-freudians moved away from many of freud's ideas because they believed that: freud placed too much emphasis on how adulthood shaped personality. freud's theory focused too much on conscious decisions. freud's idea of the unconscious was incorrect. freud focused to much emphasis on sexual and aggressive instincts. freud's ideas about the id, ego, and the superego were incorrect.

Answers

Answer 1

The neo-freudians moved away from many of freud's ideas because they believed that Freud focused too much emphasis on sexual and aggressive instincts. Option D is correct.

Who were the neo-Freudians?

They were a group of psychologists who were influenced by Sigmund Freud's ideas about the unconscious mind and personality development, but who also departed from many of his specific theories and concepts.

Therefore, they believed that Freud overemphasized sexual and aggressive instincts and focused too much on early childhood experiences as determinants of personality.

Find out more about Freud at:

https://brainly.com/question/2706543

#SPJ1


Related Questions

What is the minimum time frame allotted to inform ACHA of a CHOW?

Answers

The minimum time frame allotted to inform ACHA of a CHOW (Change of Ownership) can vary depending on the state and specific regulations. It is important to check with the local regulatory agency to determine the exact time frame required for reporting a CHOW.

In some cases, the time frame may be as little as 10 days, while in others it may be up to 60 days or more. It is crucial to ensure that all required documentation and notifications are submitted within the allotted time frame to avoid any penalties or delays in the CHOW process.The time frame for informing ACHA (or any relevant regulatory agency) of a CHOW can vary depending on the state and specific regulations. It is important to check with the local regulatory agency to determine the exact time frame required for reporting a CHOW. In some cases, the time frame may be as little as 10 days, while in others it may be up to 60 days or more. It is crucial to ensure that all required documentation and notifications are submitted within the allotted time frame to avoid any penalties or delays in the CHOW process.

learn more about time here

https://brainly.com/question/1599729

#SPJ11

What is one phenomenon that makes cross-cultural comparison difficult?reference-group effectmathnational pridelocation bias

Answers

One phenomenon that makes cross-cultural comparison difficult is the reference-group effect.

The reference-group effect refers to the tendency for individuals to evaluate themselves and their own culture in comparison to others, rather than evaluating cultures objectively.

This can result in biases and stereotypes that make it difficult to accurately compare and understand different cultures. For example, individuals may view their own culture as superior or "normal" and view other cultures through a lens of cultural relativism. This can make it challenging to accurately assess the similarities and differences between cultures and can lead to misunderstandings and miscommunication.

To know more about culture here

https://brainly.com/question/25010777

#SPJ4

What were two effects of US psychology's embrace of evolution?

Answers

The US psychology's embrace of evolution led to two significant effects: the development of functionalism and the growth of comparative psychology.

Firstly, functionalism emerged as a result of incorporating evolutionary theory into psychology. Spearheaded by figures like William James and John Dewey, functionalism focused on understanding the adaptive functions of psychological processes.

Instead of merely describing mental processes, functionalists sought to uncover how these processes contributed to an individual's ability to adapt to their environment. This shift in perspective led to a greater emphasis on studying the practical applications of psychology and its relevance to everyday life, paving the way for fields such as educational and industrial-organizational psychology.

Secondly, the growth of comparative psychology was another effect of embracing evolution in US psychology. As psychologists became more interested in the principles of natural selection and adaptation, they started exploring the similarities and differences between various species' psychological processes.

This comparative approach allowed psychologists to gain insights into the evolutionary origins of human cognition, emotion, and behavior. Researchers like Edward Thorndike and Ivan Pavlov conducted groundbreaking experiments on animal learning, which not only advanced the understanding of animal behavior but also provided valuable insights into human psychology.

For more such questions on psychology, click on:

https://brainly.com/question/9194862

#SPJ11

T/F People who are inclined to savor are generally more self-confident and gratified and less hopeless and neurotic.

Answers

The statement "people who are inclined to savor are generally more self-confident and gratified and less hopeless and neurotic." is true.

Savoring refers to the ability to fully enjoy and appreciate positive experiences in life. People who savor tend to focus on the positive aspects of their lives, which can lead to increased self-confidence and feelings of gratification.

This positive mindset helps them maintain a sense of optimism and hope, reducing feelings of hopelessness. Additionally, savoring helps individuals cope with stress more effectively, which can reduce neuroticism.

Neuroticism is characterized by emotional instability, anxiety, and moodiness. By savoring positive experiences and emotions, individuals can create a more balanced emotional state, promoting overall mental well-being.

To know more about Neuroticism click on below link:

https://brainly.com/question/27131860#

#SPJ11

Situations in which we harm the collective well being or the good of the group by pursuing our personal or self-interest are called:
a) Social traps
b) Conflicts
c) Super ordinate goals
d) Norms
e) Self- fulfilling prophecies

Answers

Social traps are situations in which we hurt the communal well-being or the good of the group by pursuing our own or self-interest. The correct option is "A".

Social traps are situations in which individuals or groups act in ways that impair the collective well-being or the benefit of the group in the pursuit of their self-interest. These conditions generate a clash between individual and group interests, which can have detrimental consequences for everyone concerned.

Overfishing, pollution, and the tragedy of the commons are all examples of social traps. Overcoming social traps frequently necessitates cooperation and coordination between individuals or groups in order to discover a mutually advantageous solution that benefits both the individual and the group.

The correct option is "A".

To know more about Social traps, click here.

https://brainly.com/question/29425528

#SPJ4

Were Aztec warriors paid to fight, or did they hold other jobs?

Answers

Answer:  In Aztec society, the role of a warrior was highly valued, and they were respected members of society. Aztec warriors were not paid in the traditional sense, but they were rewarded with various privileges and honors. They received their basic needs such as food, clothing, and housing from the state. However, Aztec warriors were also farmers, traders, or craftsmen when they were not fighting. They would spend most of their time engaged in their primary profession, and only when needed would they be called to serve in military campaigns.

It is also worth noting that becoming a warrior was not an easy task, and it required rigorous training and discipline. Only those who showed exceptional bravery and skill in battle could earn the title of "eagle" or "jaguar" warrior, which were the most prestigious ranks among the Aztec warriors. So, while warriors did not receive payment for their services, the status and recognition they received were highly valued in Aztec society.

Explanation: can i get brainliest :D kinda long i know ..

Answer:

Aztec warriors were not paid to fight, but they did hold other jobs.

Explanation:

Aztec warriors were not just bloodthirsty savages who loved to chop off heads and rip out hearts. They had other hobbies and interests too, you know. They had families and friends, they enjoyed music and poetry, they cultivated crops and crafts, they traded goods and services, they worshipped gods and goddesses, and they even had a sense of humor. Well.... sort of.

For example, one of their favorite jokes was to pretend that they were going to sacrifice someone to the sun god, but then at the last moment, they would say "just kidding" and let them go. Of course, this was only funny if the person was not actually an enemy or a prisoner of war. Otherwise, they would really go through with it. But hey, that's comedy for you.

Another way that Aztec warriors showed their wit was by making fun of their own profession. They would often mock themselves for being too brave or too foolish, for being too loyal or too greedy, for being too skilled or too clumsy. They would also tease each other about their ranks and rewards, their weapons and armor, their victories and defeats. They knew that war was a serious business, but they also knew that laughter was a good medicine.

So the next time you think of Aztec warriors, don't just picture them as fierce fighters who lived for war. Remember that they were also human beings who lived for peace. And sometimes, they even laughed.

A systematic and organized way to study problems, policy alternatives, or the effectiveness of government programs is called ______.

Answers

A systematic and organized way to study problems, policy alternatives, or the effectiveness of government programs is called policy analysis

. Policy analysis is a methodical approach to identifying and assessing policy problems, developing and evaluating alternative policy solutions, and making recommendations for policy action based on the available evidence.

Policy analysis typically involves several key steps, including defining the problem, conducting research and data analysis, identifying and evaluating policy options, assessing the potential impacts of different policy choices, and making recommendations based on the analysis.

Policy analysts often work in government agencies, think tanks, non-profit organizations, or consulting firms, and may focus on a range of policy areas, such as education, health care, environmental policy, or social welfare.

The goal of policy analysis is to provide decision-makers with the information and evidence they need to make informed policy choices that are based on a comprehensive understanding of the issue at hand. By using a systematic and rigorous approach to policy analysis, analysts can help to ensure that policy decisions are based on sound evidence and are aligned with the public interest.

Learn more about systematic  here:

https://brainly.com/question/28609441

#SPJ11

michael, accused of assault, was found incompetent to stand trial 16 years ago. since that time, he has been held in a state mental facility. this is likely in violation of .

Answers

16 years ago, Michael, who was charged with assault, was deemed unable to stand trial. He has been housed in a state psychiatric hospital ever since. This probably contravenes Jackson v. Indiana (1972).

Describe Jackson v. Indiana case.

The Supreme Court concluded in Jackson v. Indiana (1972) that the government may hold dangerous offenders who may not be able to stand trial.

The U.S. Supreme Court ruled in Jackson v. Indiana (1972) that states may not imprison criminal defendants for an unlimited period of time based alone on their inability to stand trial. The Court ordered that the commitment period be restricted based on the prospect of restoration, but it did not specify any time frames.

To learn more about Jackson v. Indiana, visit:

https://brainly.com/question/29483302

#SPJ1

Proponents of Offshore balancing criticize American efforts to promote democracy in the Middle East.A. TrueB. False

Answers

Answer:

True

Explanation:

hope this helps

An airplane is flying on a compass heading (bearing) of 340° at 325 mph. A wind is blowing with the bearing 320° at 40 mph. Find the actual ground speed and direction of the plane.

Answers

Therefore, the actual ground speed and direction of the plane are approximately 255.3 mph at a bearing of 316.5° (360° - 43.5°).

In this diagram, A represents the starting point of the plane, P represents the position of the plane after one hour of flight, and the vector AP represents the actual ground speed and direction of the plane.

Actual ground speed and direction of the plane, we need to find the vector sum of the velocity of the plane and the velocity of the wind. We can break down each velocity vector into its north-south and east-west components using trigonometry:

Velocity of the plane:

North-south component: 325 cos(340°) ≈ -221.8 mph (negative because it is heading north of due west)

East-west component: 325 sin(340°) ≈ 158.7 mph (positive because it is heading east of due south)

Velocity of the wind:

North-south component: 40 cos(320°) ≈ -28.8 mph (negative because it is blowing south of due west)

East-west component: 40 sin(320°) ≈ 20.5 mph (positive because it is blowing east of due south)

Now we can add the north-south and east-west components separately:

North-south component of AP = -221.8 mph - (-28.8 mph) = -193 mph

East-west component of AP = 158.7 mph + 20.5 mph = 179.2 mph

We can use the Pythagorean theorem to find the magnitude (speed) of the vector AP:

|AP| = [tex]\sqrt{((-193 mph)^2 + (179.2 mph)^2) }[/tex]

≈ 255.3 mph

To find the direction of the vector AP, we can use inverse tangent:

Angle of AP = tan(179.2 mph / -193 mph)

≈ -43.5°

Note that the angle is negative because it is measured clockwise from due north.

Learn more about speed visit: brainly.com/question/13943409

#SPJ4

A fully sprinkled ALF must conduct how many fire drills annually?

Answers

A fully sprinkled ALF (Assisted Living Facility) must conduct at least four fire drills annually.

The fire safety requirements for assisted living facilities (ALFs) are regulated by state and local authorities, and they can vary from one jurisdiction to another. However, the National Fire Protection Association (NFPA) has established guidelines for fire safety in healthcare facilities, including ALFs.

According to NFPA 101: Life Safety Code, fully sprinkled ALFs must conduct at least four fire drills annually. In addition to conducting regular fire drills, ALFs are also required to have a written emergency evacuation plan and to ensure that all staff members are trained in emergency procedures.

To know more about ALF , click here.

https://brainly.com/question/31562321

#SPJ4

Question 46
The US site that appears to be the focus of consideration for the nation's first permanent repository for nuclear waste is in:
a. Hanover, WA
b. Selma, AL
c. Yucca Mountain, NV
d. Atlanta, GA

Answers

The US site that appears to be the focus of consideration for the nation's first permanent repository for nuclear waste is in: option c. Yucca Mountain, NV

Yucca Mountain, Nevada, is an ideal location for the disposal of nuclear waste because it is a dry desert with little precipitation and little contamination from the waste.Yucca Mountain, Nevada is a wide stretch of 160 km of dry desert with next to no precipitation. The correct answer is option c.

All of these aspects would effectively safeguard the waste and stopharmful radioactive radiation from leaking from the disposal storage.As a result, Yucca Mountain in Nevada is a potential location for the disposal of nuclear waste.

Find out more here about yucca mountain

https://brainly.com/question/28588450

#SPJ4

The correct answer is c. Yucca Mountain, NV. Yucca Mountain has been under consideration as a potential repository for nuclear waste for decades, and it is currently the focus of the US government's efforts to establish a permanent storage site for spent nuclear fuel and other high-level radioactive waste.

Yucca Mountain is a mountain located in the Nevada desert, United States. It is known for its controversial role as the proposed site for a permanent deep geological repository for spent nuclear fuel and other high-level radioactive waste. The US Department of Energy selected Yucca Mountain as the site for this repository in 2002, but the project has faced significant opposition from environmentalists, politicians, and local residents. The project has been on hold since 2010, and in 2019 the Trump administration proposed restarting it, but it remains a contentious issue with no clear resolution in sight.

Learn more about Yucca Mountain here:

https://brainly.com/question/28588484

#SPJ11

Question 46 Marks: 1 In the quality of life index, the economic environment includes all of the following exceptChoose one answer. a. income b. work satisfaction c. economic security d. material quality

Answers

In the quality of life index, the economic environment includes all of the following except work satisfaction.

The quality of life index takes into account various factors to measure a person's overall well-being. The economic environment mainly focuses on aspects like income, economic security, and material quality.

These factors contribute to a person's financial stability and access to resources. However, work satisfaction is not a part of the economic environment, as it relates more to job fulfillment, work-life balance, and personal growth, which are different aspects of the quality of life index.

To know more about work satisfaction click on below link:

https://brainly.com/question/15418685#

#SPJ11

In the United States, the final stage of policy making, referred to as ______, often gets little attention. Rather, our governments spend much more of their efforts on the ______ stage of policy making.

Answers

In the United States, the final stage of policy making, referred to as implementation, often gets little attention.

Rather, our governments spend much more of their efforts on the formulation stage of policy making. This is because the formulation stage involves the development of policy proposals and the consideration of various options, which often receive more media attention and public scrutiny.

Implementation, on the other hand, involves the actual carrying out of policies and can be complex and time-consuming, often requiring cooperation from multiple levels of government and various stakeholders.

However, successful implementation is crucial for policies to have their intended impact, and policymakers must devote adequate resources and attention to this stage for policies to be effective.

To know more about stakeholders click on below link:

https://brainly.com/question/29532080#

#SPJ11

Decisions related to staying single or marrying are prompted by the need for social connections. Is it true or false?

Answers

Yes, the above statement is true, decisions related to staying single or marrying are often prompted by the need for social connections.

The sensation of being near to and connected to people is known as social connection. It is the cornerstone of interpersonal relationships and involves having a sense of being loved, taken care of, and cherished. Social interaction can boost our immune systems while reducing anxiety and sadness, assisting with mood control, and raising self-esteem and empathy. We jeopardize our health by ignoring our urge to connect.

People may choose either option based on their personal preferences, values, and desire for companionship and support from their social networks. Personal preferences, values, freedom of making a decision, family support, desire for companionship, and support of community affect the decision of being single or married.

To learn more about Social connection, click here:

https://brainly.com/question/30837083

#SPJ11

The influence of domestic groups on US foreign policy often rests on their ability to induce or pressure significant proportions of their members to pay some of the costs associated with lobbying government officials.A. TrueB. False

Answers

The given statement "The influence of domestic groups on US foreign policy often rests on their ability to induce or pressure significant proportions of their members to pay some of the costs associated with lobbying government officials." is because US foreign policy influence the government.

Interest groups and lobbying groups are able to influence foreign policy decisions in the US political system through a variety of options, of including campaign donations, grassroots activism, and direct lobbying of government officials.

When these organizations are able to mobilize substantial support from their members or other constituencies and are able to present strong arguments that convince decision makers, they frequently excel in affecting foreign policy outcomes.

These lobbying efforts can be expensive, and organizations are able are to raise a large sum of money frequently have a better chance of influencing policy outcomes than those who are unable to do so.

Learn more about foreign policy at:

brainly.com/question/27950081

#SPJ4

According to Gottman, which of the following is NOT a characteristic of communications in marriages that will fail:
a. Hostile criticism
b. Stonewalling
c. Contempt
d. Straight talk

Answers

Straight talk is NOT a characteristic of communications in marriages that will fail .

Straight talk involves honest, direct communication without being critical or contemptuous towards one's partner. On the other hand, Gottman identified hostile criticism, stonewalling, and contempt as communication styles that are highly predictive of divorce. Hostile criticism involves attacking one's partner's character or personality instead of focusing on specific behavior. Stonewalling is a pattern of emotional withdrawal and shutting down during conflicts. Contempt involves behaviors such as name-calling, eye-rolling, and sarcasm, which convey a lack of respect and admiration towards one's partner. By contrast, straight talk can help build trust, emotional intimacy, and long-lasting relationships.

Learn more about stonewalling

https://brainly.com/question/27895906

#SPJ4

Interest groups perform all of the following roles in politics EXCEPT this one:
a. representing their members' views to government
b. electing members to public office
c. providing an avenue for citizen participation in politics
d. educating policymakers regarding issues important to the interest group
e. alerting the proper government authorities about the group's issue to get the issue on the political agenda

Answers

Interest groups perform all of the roles mentioned in the question except for "b. electing members to public office." While interest groups may endorse or support candidates who align with their views, they do not have the power to directly elect individuals to public office.

What is Interest groups perform?

Interest groups perform all of the following roles in politics EXCEPT electing members to public office (option b).

They do represent their members' views to the government, provide an avenue for citizen participation in politics, educate policymakers on important issues, and alert government authorities about their group's issue to get it on the political agenda. However, they do not directly elect members to public office.

To know more about Interest groups.

visit:

https://brainly.com/question/28286086

#SPJ11

help guys thank you so much!​

Answers

Answer: 1: Room service is a hotel amenity that allows guests to order food and drink to their rooms. Hotel staff arrange the meal with the appropriate dishware and condiments on a room service tray. It's an in-room dining best practice to offer guests a rolling room service table in case they don't want to eat in bed.

Explanation: 2: Change bed linen and make beds.

Replace used towels.

Sweep and mop floors.

Vacuum carpets.

Dust furniture.

Replenish bath care products (e.g. soap and shampoo)

Restock beverages and food items in the mini-bar.

Clean public areas, like corridors.

3: The standard tipping amount for hotel bartenders and waiters is the same as the rule of thumb for room service: 15% to 20%, depending on how satisfied you are with the service.

Jurisdiction is: The study of law A federal court concept The authority of a court to decide a particular type of case Applicable only to Appeals Courts None of the above

Answers

The authority of a court to decide a particular kind of case is known as jurisdiction.

The authority of a court to hear and decide cases is known as jurisdiction in law. This authority is established by the Constitution.

The consent of the States to which it is open determines the Court's jurisdiction in contentious proceedings1. The manner in which a case can be brought before the Court is determined by the form in which this consent is expressed.

A legal body's jurisdiction is its authority to administer justice within a defined area of responsibility. According to Articles 131, 133–136, and 143 of the Indian Constitution, the Supreme Court in India has three distinct jurisdictions: advisory, appellate, and original.

To learn more about jurisdiction here

https://brainly.com/question/12448353

#SPJ4

when was the idea of human-induced global warming first proposed

Answers

The idea of human-induced global warming was first proposed in 1896 by Swedish scientist Svante Arrhenius.

Svante Arrhenius hypothesized that human activities, such as burning fossil fuels, could increase atmospheric CO₂ levels, leading to a rise in global temperatures.

He conducted calculations on the relationship between CO₂ and temperature, laying the foundation for modern climate science. His work was initially met with skepticism, but by the mid-20th century, advances in technology and further research helped confirm and refine the understanding of human-induced global warming.

Today, the majority of climate scientists agree that human activities are significantly contributing to climate change through the release of greenhouse gases, such as CO₂, into the atmosphere.

To know more about global warming click on below link:

https://brainly.com/question/12908180#

#SPJ11

when tom stops at george wilson's garage to put gas in gatsby's car, myrtle wilson is staring out the upstairs window. at whom is she staring

Answers

When Tom stops at George Wilson's garage to put gas in Gatsby's car, Myrtle Wilson is staring out the upstairs window. She is staring at Tom Buchanan.

Myrtle is George's wife and is having an affair with Tom. She mistakes the car's owner, Gatsby, for Tom because she knows Tom is wealthy and assumes the fancy car belongs to him. Myrtle watches Tom from the window, believing he is driving Gatsby's car.

However, she does not realize that the car's actual owner is Jay Gatsby, and Tom is only borrowing it.

Her actions reflect her dissatisfaction with her current life and marriage, as she is drawn to Tom's wealth and status. This scene foreshadows later events in the novel, as Myrtle's obsession with escaping her situation ultimately leads to tragic consequences. The misunderstanding about the car's ownership also plays a crucial role in the unfolding of the story.

In summary, when Tom stops at George Wilson's garage to put gas in Gatsby's car, Myrtle Wilson is staring out the upstairs window at Tom Buchanan, with whom she is having an affair. She mistakenly believes that Tom owns the car, which further fuels her desire to be with him.

To know more about Tom Buchanan refer here:

https://brainly.com/question/30287128#

#SPJ11

Basins formed by strike-slip faults are called ________ pull-apart basins.

Answers

Basins formed by strike-slip faults are called "pull-apart basins."

Pull-apart basins are a type of structural basin that forms as a result of the movement along strike-slip faults. Strike-slip faults are characterized by the horizontal movement of blocks on either side of the fault, in which one block moves past the other. These faults can create a gap or "opening" motion that allows for the formation of pull-apart basins.
The formation process of pull-apart basins can be broken down into several steps:
1. Two parallel strike-slip faults develop and start moving in opposite directions, either right-lateral or left-lateral.
2. As the blocks on either side of the faults move horizontally, they create an extensional environment, causing the area between the faults to widen.
3. The widening area between the faults causes the crust to stretch and thin, leading to subsidence or sinking of the area between the faults.
4. The subsiding area forms a basin, which collects sediment and water, creating a pull-apart basin.
5. Over time, the pull-apart basin continues to deepen and accumulate sediment, which can lead to the formation of sedimentary rock layers.
In summary, pull-apart basins are formed by the horizontal movement of blocks along strike-slip faults, leading to the stretching and subsidence of the area between the faults. This creates a basin that collects sediment and water, deepening over time as sedimentation continues.

For more such questions on strike-slip faults

https://brainly.com/question/810722

#SPJ11

If you have a telescope that is observing light with wavelengths of a few meters, you are observing __________

Answers

If you have a telescope that is observing light with wavelengths of a few meters, you are observing radio waves.

So, the correct answer is Radio waves.

Radio Waves:

James Clerk Maxwell predicted radio waves in 1867 with his theory of electromagnetism.

Radio waves are a form of electromagnetic radiation with the longest wavelengths and frequencies of 300 GHz and below. Radio waves can be generated artificially by transmitters and received by antennas connected to radio receivers. They are widely used for communication, broadcasting, radar, and navigation systems, among other applications.

Learn more about Electromagnetic Radiation here:

https://brainly.com/question/27219042

#SPJ4

The given question is incomplete, Hence, the complete question is:

If you have a telescope that is observing light with wavelengths of a few meters, you are observing __________.

a. visible light

b. ultraviolet light

c. gamma rays

d. radio waves

e. infrared light

f. X rays

What are the 3 sources of confusion and disorder in conflict?

Answers

The three sources of confusion and disorder in conflict include miscommunication, Unclear goals or expectations and emotional responses.

There are multiple sources of confusion and disorder in conflict, but here are three common ones. Miscommunication occurs when parties in conflict fail in effective communication or misunderstand each other, confusion can arise. This can happen when messages are not clear, when nonverbal cues are missed, or when language barriers are present. Unclear goals or expectations occur if the parties involved in a conflict are not clear on what they want to achieve or what they expect from the other party, disorder can result. When goals and expectations are unclear, it can be difficult to resolve the conflict constructively. Strong emotions such as anger, fear, and sadness can lead to confusion and disorder in conflict situations. Emotions can cloud judgment and make it difficult to see the situation clearly, leading to reactive rather than proactive responses.

Learn more about communication here :

https://brainly.com/question/8635385

SPJ11

involuntary separation of groups by legal or social means, based on race or ethnicity

Answers

The term for the involuntary separation of groups by legal or social means based on race or ethnicity is called segregation.

Segregation can occur in various forms, such as the segregation of public facilities, schools, neighborhoods, and even entire cities. Historically, segregation was enforced by laws known as "Jim Crow" laws in the United States, which mandated separate facilities and services for Black and white people.

While many of these laws have been repealed, the legacy of segregation continues to impact communities and individuals today. Segregation often leads to unequal access to resources and opportunities, perpetuating systemic racism and discrimination.

Efforts towards desegregation and promoting diversity and inclusion remain important in achieving a more just and equitable society.

To know more about racism click on below link:

https://brainly.com/question/12395639#

#SPJ11

In the _____ stage of group development, the focus should be on building trust and developing team cohesion. A. entry. B. work. C. action. D. reflection.

Answers

In the entry stage of group development, members are just getting to know each other and building relationships. This is an important time to establish trust and develop a sense of team cohesion, So the correct option is A.

so that members feel comfortable working together and are invested in the success of the group. Activities during this stage might include ice-breakers, team-building exercises, and goal-setting sessions. It is also important for members to understand the group's purpose and their individual roles within it. Once the entry stage is complete, the group can move on to the work stage, where they focus on accomplishing tasks and achieving their goals.

Learn more about cohesion,

https://brainly.com/question/29598400

#SPJ4

What is the World Council of Scholars and why is it significant?

Answers

The World Council of Scholars is a global organization made up of intellectuals and experts in various fields.

It was formed as a result of a movement to advance scientific knowledge and understanding throughout the world, particularly in the aftermath of World War I.

The Council serves as a platform for sharing ideas, research, and discoveries, and works towards promoting scientific and intellectual progress. Its significance lies in the fact that it brings together some of the brightest minds from all over the world, fostering cooperation and collaboration among scholars and promoting the advancement of knowledge for the betterment of humanity.

To know more about World War I, please click on:

https://brainly.com/question/28927253

#SPJ11

a psychologists who focuses on making cross-cultural comparisons and testing the parameters of psychological concepts and theories would likely conduct their research from an . group of answer choices exploratory research perspective etic perspective emic perspective indigenous cultural study perspective

Answers

A psychologist who focuses on making cross-cultural comparisons and testing the parameters of psychological concepts and theories would likely conduct their research from an A. perspective etic.

A psychologist that concentrates on cultural comparisons and evaluating the boundaries of psychological notions and theories would most likely undertake their research in an exploratory manner.

The etic perspective is a multi-cultural way of studying behavior that is not part of the cultural system. The emic approach, which is primarily based on one culture, investigates behavior from within the culture. The indigenous historical study viewpoint is a multi-level cultural study.

Cross-cultural psychology can investigate various subjects, including child development, emotions, linguistic learning and creation, relationships, and others. As an example, there has been stimulating study on the culture of young people, lesbian culture, and narcotics and gang culture.

learn more about perspective etic here:

https://brainly.com/question/31498718

#SPJ4

a psychologist who focuses on making cross-cultural comparisons and testing the parameters of psychological concepts and theories would likely conduct their research from an

A. perspective etic

B. perspective emic

C. indigenous cultural study

D. All of the above

based on economic analysis, why do so many people decide not to vote?a. the benefits of voting are nonexcludableb. the costs of voting are nonrivalc. the benefits of voting are rivald. the costs of voting are excludablee. the benefits of voting outweigh the costs

Answers

Based on economic analysis, one reason why so many people decide not to vote is that the costs of voting are often higher than the perceived benefits. This can be attributed to several factors, including the fact that the benefits of voting are non-excludable, meaning that individuals cannot be excluded from enjoying the benefits of a particular election even if they do not vote.

On the other hand, the costs of voting are often non-rival, which means that the resources required to cast a vote are not shared by all individuals equally. Additionally, the costs of voting can be excludable, as they may require certain resources such as time off work, transportation, and other expenses.

while the costs of voting may be high, the benefits of voting can outweigh them in certain circumstances. For example, when the issues at stake in an election are particularly important to an individual or their community, the benefits of having their voice heard and their vote counted may be significant enough to justify the costs of voting. Additionally, when a particular election is expected to be closely contested, the individual's vote may have a greater impact on the outcome, making the benefits of voting more tangible.

To learn more about, economic

https://brainly.com/question/12121311

#SPJ11

Other Questions
Question 9The factor used to determine the bromine residual with the chlorine test kit (DPD):a. multiply chlorine residual by 2.25b. multiply chlorine residual by 4c. divide chlorine residual by 4d. divide chlorine residual by 2.5 Find the volume of the cylinder in terms of . A. 154 cm3 B. 406 cm3 C. 539 cm3 D. 1078 cm3 According To the law of marginal diminishing return, if a variable factor input to a given amount of fixed factor is increased by a firm keeping the technology as constant, what will be observed about the marginal product of the variable input? A. Eventually it will decline B. It will constantly increase C. It will always remain same D. None of above a developmental task of middle adulthood is: developing leisure time activities coping with a partner's death preparing for one's own death learning to live with a partner What happens to the lieutenant who holds his wounded right arm carefully in his left hand? Which pricing objective is associated with the phrase "charging what the market will bear"?a.volume-orientedb.profit-orientedc.cash flowd.market demande.status quo You push with a steady force of 19 N on a 46-kg desk fitted with casters (wheels that swivel) on its four feet.How long does it take you to move the desk 5.1 m across a warehouse floor? Question 34Perhaps the most important determinant of the cancer-causing potential of asbestos is:a. the type of asbestos mineral to which one is exposedb. the physical properties of asbestosc. the chemical properties of asbestosd. the size of the asbestos fibers to which one is exposed please translate to genetic code:GACCAAAUGGUAGCUAACUUUUGCAAUUUUAGGUCAAGGUA Percussion of the costovertebral angle that results in the reproduction of symptoms:a. Signifies radiculitisb. Signifies pseudorenal painc. Has no significanced. Requires medical referral PLEASE HELP ASAPThe table shows values for functions f(x) and g(x).x f(x) g(x)1 7 73 10 35 0 57 5 09 5 511 7 11Which answers are solutions to the equation f(x)=g(x)?Select each correct answer.Responses135910 A key component of DSS is the ability to visualize the results. For example, it is important for executives to visualize the results of modifying assumptions.Select one:TrueFalse Critical-Thinking Question A: You are President Roosevelt's chief advisor on nationalsecurity issues. What would you advise the president to do? Why?A. Intern-place in armed camps-all Germans, Italians, and Japanese citizens andnoncitizens, approximately one million people.B. Intern only those Germans, Italians, and Japanese that appear to be disloyal.C. Place all Japanese citizens and noncitizens, regardless of age, gender, or place of birth, ininternment camps well away from strategic coastal areas.D. Establish zones around military installations and strategic areas and require an entry pass.E. Deal with Germans, Italians, and Japanese the same way as other U.S. citizens-on acase-by-case basis. Proven enemy collaborators should be sent to jail or interned. Chase is not an effective speaker because he uses very informal language.O Chase is not an effective speaker because he is notconfident about his idea.O Chase is a very effective speaker because he comesprepared to share. Chase is a very effective speaker because he communicates non-verbally. In which event of a muscle cell action potential do potassium channels open and K+ ions rush out of the cell? plpa a heteroecious rust is one that group of answer choices has five spore stages in its life cycle has fewer than five spore stages in its life cycle completes its life cycle on a single plant host species completes its life cycle on two distinct plant host species none of the others All of the following are tools and techniques used in the Control Procurements process except: 50 points pls help me What does Mr. Link Deas mean when he says, "Don't know why you touched it in the first place...You've got everything to lose from this, Atticus. I mean everything"? In 1947, Wassily Leontief tested the H-O theory for the United States and to his surprise found that the US exported more labor- intensive goods, rather than capital goods. How does your textbook explain this seeming contradiction?