What number is 16% of 60

Answers

Answer 1

Answer:

9.6

Explanation:

Answer 2

Answer:

9.6

Explanation:

16 x 60/ 100 = 16 x 6/10 = 9.6, hope this helps :D


Related Questions

10 points and choose 3 lines of what it is and please be right

Answers

Answer:

“we have before us many, many long months of struggle and suffering”

“we have before us a deal of the most grievous kind”

“victory at all costs, victory in spite of terror...”

all the pupils at the knight school Gawaine le Cur-Hardy was among the least promising. He was tall and sturdy, but his instructors soon discovered that he lacked spirit. He would hide in the woods when the jousting class was called, although his companions and members of the faculty sought to appeal to his better nature by shouting to him to come out and break his neck like a man. Even when they told him that the lances were padded, the horses no more than ponies and the field unusually soft for late autumn, Gawaine refused to grow enthusiastic. The Headmaster and the Assistant Professor of Pleasaunce were discussing the case one spring afternoon and the Assistant Professor could see no remedy but expulsion.
“No,” said the Headmaster, as he looked out at the purple hills which ringed the school, “I think I’ll train him to slay dragons.”

“He might be killed,” objected the Assistant Professor.

“So he might,” replied the Headmaster brightly, but he added, more soberly, “we must consider the greater good. We are responsible for the formation of this lad’s character.”

“Are the dragons particularly bad this year?” interrupted the Assistant Professor. This was characteristic. He always seemed restive when the head of the school began to talk ethics and the ideals of the institution.

“I’ve never known them worse,” replied the Headmaster. “Up in the hills to the south last week they killed a number of peasants, two cows and a prize pig. And if this dry spell holds there’s no telling when they may start a forest fire simply by breathing around indiscriminately.”

“Would any refund on the tuition fee be necessary in case of an accident to young Cur-Hardy?”

“No,” the principal answered, judicially, “that’s all covered in the contract. But as a matter of fact he won’t be killed. Before I send him up in the hills I’m going to give him a magic word.”

“That’s a good idea,” said the Professor. “Sometimes they work wonders.”

6. What is this passage about?
The problems that may arise from fighting dragons
How the educators would change Gawaine’s course of study
The way the Professor and the Headmaster taught about dragons
Giving Gawaine a magic word to help him fight dragons
7. What is the best way to describe Gawaine’s character?
Fearless and excitable
Careless and frigid
Spiritual and careful
Cowardly and apathetic
8. What is the meaning of “his better nature”?
An increased sense of honesty
A man’s ignoble ideas
A desire for propriety
A man’s nobler instincts

Answers

Answer:

6.B

7.D

8.D

Explanation:

6.While some of the other choices are mentioned in the selection, they do not adequately explain what the entire selection is about.

7.Gawaine is said to be tall and sturdy, but would run away and hide at the smallest sign of trouble.

8.“His better nature” is a common way of talking about a person’s deeper character.

How do events on the day of the party affect the conflict between Rosaura and her mother?

Answers

The main conflict in this story is the person vs society. Rosaura is facing the struggles of her place in the world, while she is stuck being poor surrounded by rich friends. Her first struggle is fighting against her mother to let her go to Luiana’s party.

PLS I ONLY HAVE A FFEW MIN TO DO IT

Answers

Answer:

a

Explanation:

Pls help i need this bad

Answers

that they treated there empower with respect because he’s on the top(on the social heirarchy)

Why is it important to site sources? Name at least three reasons.

Sample response: It is important to site sources because authors should be given credit for their work. You should also document your sources to show that your research is reliable. Finally, documentation provides a guide for others.

Answers

Citing or documenting the sources used in your research serves three purposes: It gives proper credit to the authors of the words or ideas that you incorporated into your paper. It allows those who are reading your work to locate your sources, in order to learn more about the ideas that you include in your paper.

Answer/Explanation:

Citing or documenting the sources used in your research serves three purposes: It gives proper credit to the authors of the words or ideas that you incorporated into your paper. It allows those who are reading your work to locate your sources, in order to learn more about the ideas that you include in your paper.

Write a problem statement for music and then answer the problem statement.

Answers

Answer:

Music in this gen is difficult to listen to around adults.

Explanation:

Listening to clean wont fix it because the lyrics prob are still not appropriate. Instead listen to other music. I don't know if this helped but I hope so.


How will the motion of an object be affected if equal forces are applied in opposite directions?

Answers

Answer:

the object will not move

Explanation:

Equal forces acting in opposite directions are called balanced forces. Balanced forces acting on an object will not change the object's motion. When you add equal forces in opposite direction, the net force is zero.

Decide which problems can be solved by using proportional reasoning. Select all that apply.

Answers

Answer:

To compute the unknown term,.

Whether exercises, on:

- wheels

- on the cost of an otel

- on litres of paint

- about volumes

- about students

Explanation:

Whatever you can use to do an exercise, where you can use proportional reasoning.

i need this can you help if dont know dont answer. pls help me i am giving 100 points and brainlest

Answers

Answer:

It shows tendency, China's wars were a threat to the country's northern frontier.

I'm not sure about my answer but you can keep building on from this.

chinas nation were a threat

which of the following is made up of cells? a)Rock. b)A car. c)A raindrop. d)a leaf​

Answers

Answer:

A leaf is the answer.

I think it's helpful for you.

Your answer would be Leaf. If you use a microscope and look through it at a leaf you will see cells.A car,raindrop,and rock wouldn’t be made out of cells because they are not living.

What are 3 advantages and disadvantages of staging in a promenade theatre

Answers

1 - Exciting for the audience

2 - Creates an intimate atmosphere

3 - Allow action to move to different settings without scene changes

4 - Immersive experience

5 - May help actors to feel immersed in the world of the play

Advantages:

Exciting for the audience

Creates an intimate atmosphere

Allow action to move to different settings without scene changes

Disadvantages:

Restricts audience to those with sufficient mobility

Actors may feel intimidated

The audience may not cooperate

How should students prepare for the ACT English test?

Answers

ACT English is mostly on grammar so I would recommend students to practice on grammar by knowing correct punctuation and try to expand vocabulary
Correct punctuation most definitely

Julie worked 3 less than twice as many hours as Bruce. Which of the following choices represents the number of hours that Julie, J. worked based on the number of hours that Bruce, B, worked?

A. J = 2B - 3
B. J = 2 - 3B
C. J = 2B + 3
D. J = 3 - 2B
E. J = -2B - 3 ​

Answers

the answer is a . i hope you do well

Foes in a complex sentence
PLEASE HURRY UP AND RESPOND IM ON A TIME THINGGGGGG.

Answers

Embrace, embrace, my Sons! be foes no more!
— Alexander Pope

According to the video, what are some tasks Production, Planning, and Expediting Clerks commonly perform?
Check all that apply.
tracking output
assembling parts for equipment
moving manufacturing materials
traveling between plants
dealing with inventory
keeping on schedule
keeping records

Answers

Answer:

just did it on edgeuntiy got it on first try

Explanation:

The roles performed by Production, Planning, and Expediting Clerks include:

tracking outputdealing with inventorykeeping on schedulekeeping records.

What is production?

Production simply means the creation of goods and services for human use.

In this case, the roles performed by Production, Planning, and Expediting Clerks include tracking output, dealing with inventory, keeping on schedule, and keeping records.

Learn more about production on:

https://brainly.com/question/25071524

Use the particle theory of matter to explain why laundry detergents tend to work better in hot "water than in cold water.

Answers

I think it will be medium or hocold water
Particle theory of matter states that particles at higher temperatures move faster that those at lower temperatures. Then laundry detergents particles move faster in hot water than in cold water, and therefore, they are more efficient and work better.

Characteristics determined by an organism's genes

Answers

An organism's phenotype is determined by its genotype, but gene expression can be affected by environmental factors. These factors can alter the inherited traits of an organism.
A trait is a specific characteristic of an organism. Traits can be determined by genes or the environment, or more commonly by interactions between them. The genetic contribution to a trait is called the genotype. The outward expression of the genotype is called the phenotype.
Other Questions
a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2 6. What were the first Native American civilizations, and where were they located? Estoy tan aburrida as que aqu hay algunos puntos gratis. What percentage of Americans use solar power ? Copy the shape and fill in the missing angle. Sow the work. Thanks.