Why the same side of the moon is always facing Earth?

A.The time it takes the moon to rotate one time and the time it takes Earth to rotate one time are the same.

B.The time it takes the moon to rotate one time and the time it takes theEarth to orbit the sun one time are the same.

C.The time it takes the moon to rotate one time and the time it takes the moon to orbit Earth one time are the same.

D.The time it takes the moon to orbit Earth one time and the time it takes the Earth to orbit the moon one time are the same.

Answers

Answer 1

Answer:

A

Explanation:

the moon rotates exactly once every time it circles the Earth.


Related Questions

when you blow across the top of a soda bottle, it acts like a closed pipe. If the inside of the bottle is 0.150 m long, what is the fundamental frequency you hear?

(speed of sound=343 m/s)
(unit=hz)

Answers

Answer:

The new fundamental frequency will be 598.7Hz. The length of the soda bottle is 0.173 meters. Thus, the new fundamental frequency is 598.7Hz.

Explanation:

Please give me brainlist

Answer:2860 hz

Explanation:

Trust me

Elements with positive valences usually ______ electrons
A. Donate
B. Accept
C. Have no
D. Create

Answers

The answer is donate, therefore elements with positive valences usually donate electrons

Marcus found that the weight of a rock on Earth is 22.5 newtons. He knows that the gravity on Saturn is 0.93 times the gravity on Earth. What would the weight of this rock be on Saturn?

Answers

Answer:

The weight of the rock on Saturn would be 21.375

Explanation:

Since the weight on Saturn is 0.93 times the weight on Earth you would multiply 22.5 x0.93. This bring you too 21.375

When drawing a vector, you should represent the magnitude of the vector by the length of the arrow. A. True O B. False​

Answers

Answer: A. True

Explanation:

Answer:

A. True

Explanation:

A vector in this sense is a thing that has both magnitude (length) and direction.

Say you're walking at a speed of 5 miles per hour. If you keep walking in a straight line, then in two hours you will have walked 10 miles.

This doesn't give any information about where you started or any information about where you ended up after those 2 hours.

This is because "speed" is a scalar. It's a number with no associated geometry. It's just a magnitude. It's the magnitude of velocity.

Velocity is a vector.

A weight-lifter raises a 2000 N weight through a vertical height of 2.0m in 0.80 s.
What useful power does he develop in doing this?
A
800 W
B
3200W
с
4000 W
D
5000W

Answers

Answer:

D. 5000W

Explanation:

Given the following data;

Force = 2000N

Distance = 2m

Time = 0.8s

To find the power;

First of all, we would determine the workdone by the weightlifter

Workdone = force * distance

Workdone = 2000 * 2

Workdone = 4000N

Now, we can find the power using the formula;

Power = workdone/time

Substituting into the equation, we have

Power = 4000/0.8

Power = 5000 Watts

Help please!!! Physics circular motion

Answers

Answer:

2. 3.1415 m/s

3. 0.63m

4. 0.006 m/s^2

Explanation:

2. v=(2*pi*r))/T, put in values and solve.

3. Circumference=2*pi*radius, radius is 0.1m, plug in and solve.

4. a=(v^2)/r, (don't worry about converting to meters, since units are the same in kilometers, they will cancel out) plug in values and solve.

That's it!

If the force exerted by a man is halved and the distance is multiplied by four, by which factor does the work change ?

A. Increase by a factor of 8
B. Decrease by a factor of 2
C. Increase by a factor of 2
D. Increase by a factor of 4

Answers

increase factor by 8 thousands

F. A 50. A resistor (R2), and unknown resistor R2, a 120 Volt source, and an ammeter are connected in a
complete circuit. The ammeter reads 0.50 ampere (current).
R1
a. Determine the resistance of Rz.
R2

Answers

Complete question is;

A 50.-ohm resistor, an unknown resistor R, a 120-volt source, and an ammeter are connected in a complete circuit. The ammeter reads 0.50 ampere.

A) Calculate the equivalent resistance of the circuit shown.

B) Determine the resistance of resistor R shown in the diagram.

Answer:

A) R_eq = 240 Ω

B) R = 190 Ω

Explanation:

A) To get the equivalent resistance, we will use the formula;

R = V/I

Where;

V is Voltage

I is current

R is equivalent resistance

From the question, V = 120 V and I = 0.5A

Thus;

R_eq = 120/0.5

R_eq = 240 Ω

B) From the image, we see that the resistors are connected in series.

Formula for resistors in series is;

R = R1 + R2 +..... Rn

Thus;

240 = 50 + R

R = 240 - 50

R = 190 Ω

A) The equivalent resistance of the circuit shown will be  240 Ω.

B) The resistance of resistor R will be 190 Ω

What is resistance?

Resistance is a type of opposition force due to which the flow of current is reduced in the material or wire. Resistance is the enemy of the flow of current.

The given data in the problem is;

R is the resistance = 50.-ohm

v is the voltage = 120-volt source

I is the value of the current =0.50 ampere.

A) The equivalent resistance of the circuit shown will be  240 Ω.

According to ohm's law

[tex]\rm R= \frac{V}{I} \\\\ \rm R= \frac{120}{0.5} \\\\ \rm R=240 \ ohm[/tex]

Hence the equivalent resistance of the circuit shown will be 240 Ω.

B) The resistance of resistor R will be 190 Ω

The given resistors are connected in the series;

R = R1 + R2 +..... Rn

240 = 50 + R

R = 240 - 50

R = 190 Ω

Hence the resistance of resistor R will be 190 Ω

To learn more about the resistance refer to the link;

https://brainly.com/question/20708652

If a car used 250,000 W of power to complete a race in 12 s, how much work did the car do?

Answers

Answer:

3,000,000 Joules!

Explanation:

power=work/t

250000=work/12

work=3,000,000 Joules

How do the particles in a Longitudinal Wave move?

A) Parallel to the direction of the wave
B) Perpendicular to the direction of the wave
C) Particles do not move
D) The particle is the wave (wave packet)

Answers

Explanation:

In a longitudinal wave the particle displacement is parallel to the direction of wave propagation. The particles do not move down the tube with the wave; they simply oscillate back and forth about their individual equilibrium positions. Pick a single particle and watch its motion.

rock at the edge of a cliff has kinetic energy because of its position.
True
False

Answers

its false rock is at edge

From an apple tree 2 metres high, a 100g mass apple fell of the tree, what work did it do?

Answers

Answer:

When an apple falls from the tree to the ground, its energy of position (stored as gravitational potential energy) is converted to kinetic energy, the energy of motion, as it falls. When the apple hits the ground, kinetic energy is transformed into heat energy.

HELPPPP WILL MARK B IF CORRECT!!!!

Answers

If freckles is the dominant trait, this means every one of the genes with an upper case have freckles. This gives us:

3/4 of the offspring will have freckles. You can also say 75%

Hope this helps!! :)

A book is sitting on a table. Which of the following is true about the table? O A. It is pushing up on the book. O B. It exerts no force on the book at all. O C. It is pulling down on the book. D. It can affect the mass of the book.​

Answers

Answer:

yes it does exert a force, it pushes it up

Explanation:

this is called normal force

if it didn't exert a force the book would keep going down

according to newton every force has an equal amd opposite reaction

so the book exerts a force on the table and vice versa

hope this helped

What is 8 x 10-2 in ordinary form?​

Answers

78 is the answer hope it helps

The answer is 0.08 have a great day!

how can understanding velocity help to prevent a mid-air collision

Answers

Answer:

To maintain enough time to prevent a collision, a system operating in air traffic where aircraft speed does not

fall below 100 km/h (most medium-sized UAVs and GA aircraft) will need to be able to detect obstacles which

subtend an arc-width of as small as 0.125 mra

PLS ANSWER FAST WILL GIVE BRAINLY!!!


In order for a roller coaster to work, why does the hill the cart climbs need to be higher than the top of the loop?

Answers

Answer:

The concept of potential energy, often referred to as energy of position, is very simple: As the coaster gets higher in the air, gravity can pull it down a greater distance. ... The potential energy you build going up the hill can be released as kinetic energy — the energy of motion that takes you down the hill.

Potential energy, also known as energy of position, is a pretty straightforward idea. As the roller coaster rises in the air, gravity has a greater ability to pull it down.

What does the hill the cart climbs need?

An easy illustration involves a stopped car at the summit of a hill. The car drives faster as it goes down the hill, which results in an increase in kinetic energy and a decrease in potential energy. The vehicle changes kinetic energy into potential energy as it ascends the hill.

They are higher up at the top of the hill, thus they have more potential energy. Moving down a slope transforms potential energy into kinetic energy, while moving up a hill transforms kinetic energy into potential energy.

Therefore, You can release the potential energy you accumulate while climbing a hill as kinetic energy, which is the energy of motion that propels you down the hill.

Learn more about cart here:

https://brainly.com/question/7726236

#SPJ2

A flight distance from philadelphia to cancun is 1469 miles.the estimated flight time is 3.25 hours.What is the avarage speeede of the plane in miles per hour(number and units)?

Answers

Answer:

1469 miles /3.25 hours = 452 miles per hours

Explanation:

divide distance by the time it takes to get there

What is the limiting factor of speed for an object falling through the air?

Answers

Air Resistance is the factor, which limits the speed of an object falling through the air...⭐

____________________________________________________

<Judge It Yourself...>

Hope it helps you! ヅ

✪ Be Brainly ✪

Each bat can produce different frequencies of ultrasound. Explain why this is useful if there are many bats hunting together.

Answers

Answer: Although low frequency sound travels further than high-frequency sound, calls at higher frequencies give the bats more detailed information--such as size, range, position, speed and direction of a prey's flight. Thus, these sounds are used more often.

Explanation:

Please help me with this

Answers

I can’t see the full pic

Answer:

I can't really see it sorry

Need help with this one question!​

Answers

Answer:

Actual Mechanical Advantage

Explanation:

AMA=mg/F(applied)

I think the following ratio is called, “actual mechanical advantage.”

How do you get on the cheer squad?!

Answers

Answer:

you don't cuz cheerleaders only get in the way of the football game

Car A is stopped at a traffic light. At the moment it starts to move again, it is situated 330 m from car B, which is traveling in the opposite direction at a constant velocity of 18.0 m/s. If car A accelerates at a rate of 3.0 m/s^2, where and after how long will the two cars pass each
other?​
Please answer this question with steps..​

Answers

Answer:

hopr

Explanation:

Answer:

How do u delete your questions on this app

what is true about a pseudoscientific

Answers

Answer:

C: it ignores parts of the method within an investigation

Are acceleration and mass proportional or inversely proportional values?

Answers

Answer:

acceleration and mass are inversely proportional values

Explanation:

The acceleration of an object as produced by a net force is directly proportional to the magnitude of the net force, in the same direction as the net force, and inversely proportional to the mass of the object.

Mass is inversely proportional to acceleration.

hopefully i was able to help.

Mickey had three substances. He hit each of them with a hammer. A red
substance was malleable and easily flattened. A white crystal cracked but did
not break. A silver substance flattened but did not crack. Which two
statements could be true?
A. The silver substance is a metal,
B. The red substance is ionic,
C. The silver substance is ionic.
I D. The white substance is ionic.

Answers

Answer:

A & D

Explanation:

Took the test already

The two statements that could be true on the basis of the information given in the question are as follows:

The silver substance is metal.The white substance is ionic.

Thus, the correct options are A and D.

What are the properties of metal?

The properties of the metal are described as follows:

They are good conductors of heat and electricity.They possess high melting points and high density. They are malleable, ductile, and lustrous in nature. They are generally hard as compared to other elements.

The silver substance is metal because it is flattened into thin sheets but did not crack. This shows the property of malleability of metals. The white substance is ionic because it is cracked but did not break. It shows that ionic compounds are tough to break.

A red substance is also metal but does not express in any options.

Therefore, the correct options for this question are A and D.

To learn more about the Properties of metal, refer to the link:

https://brainly.com/question/1301107

#SPJ5

Which phrase best describes a machine?

any device that makes work easier
any device that moves an object
any device that has multiple parts
any device that uses energy

Answers

I would say that a machine is a device/apparatus that uses mechanical power and has multiple parts.

Help me on this question

Answers

Adjust the height of the wooden rod so that it just touches the surface of the water. Switch on the lamp and motor and adjust the speed of the motor until low frequency waves can be clearly observed... Count the number of waves passing a point in ten seconds then Divide by ten to record frequency.

How the choice of building materials and techniques can help them cool down faster, after heating up.

Answers

Answer:

The choice of building materials and techniques can help them cool down faster, after heating up is explained below in brief details.

Explanation:

Building materials

Buildings that are composed of rock, bricks, or pavement, or inserted into the territory, can seem cooler thanks to the great "thermal mass" of these elements – that is, their capability to assimilate and discharge heat gently, thereby softening temperatures over time, producing daytime cooler and night-time warmer.

Other Questions
un debate sobre temas controversiales como lalegalizacin de las drogas, la homosexualidad, la eutanasia y lamigracin. Toma en cuenta estructura. 7. Find the inverse of f(x) = -2x + 10. Please show work. Which is NOT a type of crowd?ConventionalO FormativeO CasualO Expressive A slide at a children's park is 74 inches tall in the horizontal distance The slide covers is 70 inches what is the angle measures created by the slide and the ground a cyclist covers a distance of 15km in 2hours calculate his speed Who suspects Macbeth of foul play? 6.The bolded words are " I long to hear you", and " I long to hear you".Read the following passage from Shenandoah. Which sound device is expressed by the bolded words?Shenandoah, I long to hear you,Away, you rolling river,Oh, Shenandoah, I long to hear you,Away, I'm bound away,'Cross the wide Missouri.A. refrainB. repetitionC. alliterationD. rhyme Civil rights in the United States are meant to make sure that: A. all races are treated equally. B. states can segregate services. C. the courts don't have too much power. D. schools get enough money to operate.I will give brainliest. Question 1 ( point) A 64g sample of Germanium-66 is left undisturbed for 12.5 hours. At the end of that period, only 2.0g remain. How many half-lives transpired during this time period? half-lives Answer = Blank 1: The sum of a number and six times its reciprocal is 10. Find the number If this work is a throne for the greatest rapper, who should occupy it? Make a case. What is the meaning of the term metabolism? The term "para" in Paralympics means? Use the points in each diagram to name the figure shown what is - 5 = -2 what is the questionwhat is the question Solve for x. Enter the solutions from least to greatest. (5x+4)(x3)=0lesser x= greater x= what's the fourth proportional of 0.2, 0.5, 6 transcribe this strand of DNA 5' 3 TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid- What is the best name for polynomial with 3 terms that has a degree PLEASE HELP ITS DONE IN 16 HOURSSS!!!question: A substance with 12 negatively charged atoms combined with a substance that has 10 positively charge atoms. What is the total charge of the substance when the atoms are combined?answer options: +22-22+2-2